Go to Top Go to Bottom
Anim Biosci > Volume 37(9); 2024 > Article
Munyaneza, Kim, Cho, Jang, Choo, and Lee: Association of histamine-N-methyl transferase gene polymorphisms with carnosine content in red-brown Korean native chickens

Abstract

Objective

Carnosine and anserine affect the meat flavor. The contents of carnosine and anserine in meat are affected by genetic and environmental factors. This study aimed to discover the single-nucleotide polymorphisms (SNPs) in the histamine-N-methyl transferase (HNMT) and histamine-N-methyl transferase-like (HNMT-like) genes and to associate them with the content of carnosine and anserine in Korean native chicken-red brown line (KNC-R).

Methods

This study used a total of 384 birds (males, n = 192; females, n = 192) aged 10 weeks old, for genotyping HNMT and HNMT-like genes. One synonymous SNP (rs29009298C/T) of the HNMT gene was genotyped by polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) methods whereas four missense SNPs (rs734406537G/A; rs736514667A/G; rs15881680G/A and rs316765035T/C) of the HNMT gene, and one missense SNP rs737657949A/C of the HNMT-like gene were genotyped by PCR allele competitive extension (PACE) genotyping technology. Two-way analysis of variance of the R program was used to associate HNMT genotypes with the contents of carnosine and anserine in KNC-R chickens.

Results

There were significant associations (p<0.05) between the genotypes of the synonymous SNP:rs29009298C/T, missense SNP rs736514667A/G of the HNMT gene and the content of carnosine in KNC-Rs. This study also reported the sex effect on the carnosine content, where females had more content of carnosine compared to that of male KNC-R.

Conclusion

Two SNPs (synonymous: rs735769522C/T) and missense: rs736514667A/G) in the HNMT gene might be used as genetic markers in the selection and breeding of chickens with better taste and high-flavored meat.

INTRODUCTION

The selection and breeding of poultry, particularly chickens, with higher growth rates to satisfy the growing demand for poultry meat has resulted in lower meat quality [1]. In contrast, native chickens grow at a slower rate and are known for their superior meat quality [24]. After tenderness and juiciness, meat flavor is the most likely trait to be used to describe the quality of the meat during consumption and influences the consumer’s decision to repurchase the meat [5]. Researchers have reported a significant association between flavor precursor content in fresh meat and the final meat flavor [613]. These precursors include nucleotides, sugars, amino acids, histidine-containing dipeptides such as carnosine and anserine, organic acids, and fatty acids [914] and are responsible for producing the final flavor [11,15]. The red-brown Korean native chicken (KNC-R) is one of the five KNC lines [2,4]. KNC-Rs tend to have a higher body weight and greater content of flavor precursors such as carnosine [2].
The genetic factors (breed or line) and environmental factors such as feed, processing and cooking methods, and storage influence the content of flavor precursors in the meat [10,16, 17]. Previous studies reported candidate genes affecting some of these flavor precursors. For example, DUSP8 and IGF2 genes influence the content of nucleotide-related compounds (IMP, inosine, and hypoxanthine) in KNC-Rs [8]. Carnosine is predominantly found in mammals, including beef and pork; by contrast, anserine is abundant in avian species such as poultry [2]. Carnosine is synthesized through the combination of the amino acids β-alanine and L-histidine [18] and is found in large quantities in skeletal muscle, the heart, and the nervous system [19]. Anserine is the methylated product of carnosine [20] and is found in skeletal muscle [21]. Carnosine and anserine are natural antioxidants and have anti-aging and neurotransmitter functions [2]. They also have anti-hypertension properties and contribute to immune boosting and insulin resistance amelioration [22]. Carnosine influences different meat quality traits [23,24]. Additionally, anserine and carnosine confer an umami taste [25].
The flavor of chicken meat is a complex trait and compounds influencing the flavor, including carnosine and anserine, can be controlled genetically [26]; thus, marker-assisted selection to produce highly flavored chicken meat is possible. Moreover, the heritabilities of carnosine and anserine have been reported as moderate for carnosine (0.383) to high (0.531) for anserine in the longissimus muscle of beef [2,23]. The heritabilities of carnosine and anserine were 0.43 and 0.24 in chicken breast meat, respectively [27]. A previous genome-wide association study (GWAS) reported that the genes histamine-N-methyltransferase (HNMT) (ENSGALG00000012377) and HNMT-like (ENSGALG 00000033461 or LOC771456) likely influence peptide content, including carnosine and anserine contents in KNCs [27]. This is the first work to identify single-nucleotide polymorphisms (SNPs) in HNMT and HNMT-like genes and investigate their associations with carnosine and anserine contents in chickens. HNMT and HNMT-like (LOC771456 or carnosine N-methyl transferase 2 [CARNMT2]) have been mapped to chromosome 7 in the chicken genome. HNMT-like is thought to be the result of gene duplication, and protein exhibits unique enzymatic activity [28,29]. HNMT and HNMT-like are involved in histidine metabolism [27]. Histidine is bound to alanine to synthesize carnosine in muscle [18,21], and carnosine is then methylated to produce anserine [28,30].
However, polymorphisms in HNMT and HNMT-like genes are scarce, and their effects on the peptide (carnosine and anserine) contents in chickens are unknown. HNMT and HNMT-like polymorphisms may affect muscle carnosine and anserine contents, influencing chicken meat flavor. Therefore, our objectives were to identify SNPs in HNMT and HNMT-like genes and explore possible associations between the identified SNPs and carnosine and anserine contents in KNC-Rs.

MATERIALS AND METHODS

Ethical statement

The protocols for animal experiments were approved by the Institution of Animal Care and Use Committee of the National Institute of Animal Science (NIAS; approval number: NIAS 20212219) to ensure the fulfillment of international guidelines for animal welfare.

Chickens and data collection

The chickens used in this study were kept at the Poultry Research Institute of the NIAS in Pyeongchang, South Korea. Feed and water were provided ad libitum. We extracted genomic DNA from 384 birds (males, n = 192; females, n = 192) to identify the SNPs in HNMT and HNMT-like. All conditions related to the maintenance, management, housing, and feeding of chickens are the same as those stated in our previous work [4]. For the carnosine and anserine analyses, we used the breast meat from 384 KNC-Rs that were slaughtered at 10 weeks of age.

DNA extraction, primer design, and polymerase chain reaction amplification

Genomic DNA was extracted from 384 KNC-R blood samples using the PrimePrep Genomic DNA Extraction Kit (GenetBio Co., Daejeon, Korea). The primer-BLAST tool of the NCBI database was used to design primer pairs for amplifying the 309-bp fragment of chicken HNMT gene (accessed by ENSGALG00000012377 in Ensembl, GRCg6a) containing the synonymous SNP rs29009298C/T. This primer set was synthesized and delivered by Bioneer Corp. (Daejeon, Korea), and are shown in Table 1.
The polymerase chain reaction (PCR) mixture (total volume: 20 μL) comprised 2 μL of genomic DNA (25 ng/μL), 1 μL of forward and reverse primer each, 10 μL of HS Prime Taq Premix (2×) (GenetBio Co., Korea), and 6 μL of triple-distilled water (3DW). PCR amplification was carried out using a T100 Thermal Cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA) with the following steps: initial denaturation at 95°C for 3 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 63°C for 45 s, extension at 72°C for 60 s, and a final extension step at 72°C for 10 min. The PCR products were separated by electrophoresis in 2% agarose gel stained with ethidium bromide at 120 V for 30 min; the fragments were visualized under an ultraviolet (UV) transilluminator (ATTO Corporation, Tokyo, Japan).

Next-generation sequencing data analysis

Next-generation sequencing (NGS) data for the KNCs were obtained from the National Agricultural Biotechnology Information Center (Jeonju, Korea) to detect and confirm the SNPs in the HNMT and HNMT-like genes of the KNC-Rs. Four missense and four synonymous variants in HNMT were identified. Additionally, one missense and three synonymous variants were discovered in HNMT-like. Here, we focused on one synonymous variant (rs29009298C/T) and all four missense variants (rs734406537G/A, rs736514667A/G, rs15881680G/A, and rs316765035T/C) of HNMT. For HNMT-like, one missense variant (rs737657949A/C) was used for genotyping.

Genotyping of HNMT and HNMT-like

We used the polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) genotyping method for the synonymous variant in HNMT (rs29009298C/T). PCR allele competitive extension (PACE) genotyping was used to determine the differences in the genetic makeup of missense variants in HNMT and HNMT-like. For genotyping of the HNMT (SNP: rs29009298C/T), we used a total volume of 20 μL composed of 15 μL of PCR product, 0.4 μL of restriction enzyme (HpyCH4IV), 2 μL of 10× CutSmart Buffer, and 2.6 μL of 3DW. The mixture was incubated at 37°C for 6 h. The HpyCH4IV restriction enzyme was selected using NEBcutter2 software (https://nc2.neb.com/NEBcutter2/).
The RFLP fragments of HNMT (rs29009298C/T) digested with the HpyCH4IV restriction enzyme were separated using 3% agarose gel electrophoresis stained with ethidium bromide at 90 V for 45 min and visualized using a UV transilluminator (ATTO Corporation, Tokyo, Japan). The PACE assay mix and PACE master mix were produced by 3CR Bioscience (Harlow, UK) to genotype the missense variants in HNMT and HNMT-like genes (Table 1). PACE genotyping was performed in a 96-well plate. Each well contained a mixture of 10 μL, composed of 1 μL of genomic DNA (5 ng/μL) or 1 μL of 3DW in the case of the negative control, 5 μL of master mix, 0.25 μL of assay mix, and 3.75 μL of 3DW. The reaction was run using the CFX Connect Real-time PCR Detection System (Bio-Rad Laboratories, Inc., USA).

Analysis of carnosine and anserine contents in KNC-Rs

The carnosine and anserine contents in the breast meat of KNC-Rs were analyzed using nuclear magnetic resonance following a previously described method [31]. The carnosine and anserine contents are expressed as milligrams per 100 grams of breast meat (mg/100 g of breast meat).

Statistical analyses

After genotyping of HNMT in KNC-Rs, the genotype and allele frequencies were calculated according to Nei and Kumar [32], in which the chi-square (χ2) test for Hardy–Weinberg equilibrium (HWE) was estimated using the formula proposed in Hartl and Clark [33]. To examine the effects of genotype and sex on carnosine and anserine contents in KNC-Rs, a two-way analysis of variance was conducted using R software ver. 4.2.1 software [34].
The mathematical model is represented by:
Yi,j=μ+Gi+Sj+ɛi,j
where Yij represents carnosine or anserine content, μ is the population mean, Gi represents genotype effects, Sj represents the effects of sex, and ɛi,j is the residual error. Significance tests between the mean value of each genotype and the contents of carnosine or anserine were carried out using Tukey’s test (p<0.05).

RESULTS

Next-generation sequencing-based identification of single-nucleotide polymorphisms

Analysis of the NGS data of KNC-Rs revealed four missense (rs734406537G/A, rs736514667A/G, rs15881680G/A, and rs316765035T/C) and four synonymous (rs317627831A/G, rs312743068T/C, rs29009298C/T, and rs735769522C/T) variants in HNMT, as well as one missense (rs737657949A/C) and three synonymous (rs317607580C/T, rs316762204A/G, and rs316857074A/G) variants in HNMT-like.

Genotyping of HNMT and HNMT-like single-nucleotide polymorphisms

A synonymous SNP (rs29009298C/T) of HNMT and missense SNPs in HNMT and HNMT-like genes were genotyped using PCR-RFLP and PACE genotyping technology, respectively. The 309-bp fragment containing the synonymous SNP in HNMT (rs29009298C/T) was successfully amplified and then digested by HpyCH4IV, yielding three genotypes: CC, CT, and TT (Figure 1). PACE genotyping of the four HNMT missense SNPs (rs734406537G/A, rs736514667A/G, rs15881680G/A, and rs316765035T/C) yielded three genotypes (Figure 1). PACE genotyping of the HNMT-like missense SNP rs737657949A/C yielded one genotype, AA.

Genotype frequencies, allele frequencies, and Hardy–Weinberg equilibrium

For the synonymous SNP: rs29009298C/T of HNMT gene, the most frequent genotype was CC, representing 64% of the total genotyped chickens, followed by the heterozygous genotype CT (34%) and TT (2%), and the C allele was the predominant allele (80%) over the allele T (20%). For the missense variant rs734406537G/A, the heterozygous genotype (AG) was the predominant genotype (50%), followed by GG (40%) and AA (10%). For the missense SNP rs73651 4667A/G, the predominant genotype was AA (61%), followed by AG (36%) and GG (3%). For the missense SNP rs15881680G/A, the dominant genotype was GG (59%), followed by AG (36%) and AA (5%). For the missense SNP rs316765035T/C, the dominant genotype was CT (50%), followed by TT (32%) and AA (18%) (Table 2). Finally, the missense SNP rs737657949A/C of the HNMT-like gene was monomorphic, with one allele (A) and one genotype (AA) (Table 2).

Association of HNMT genotypes and sex with carnosine and anserine contents in KNC-R

We found significant influences (p<0.05) of the HNMT genotypes with the synonymous SNP rs29009298C/T and the missense SNP rs736514667A/G on carnosine content in KNC-Rs (Table 3). Furthermore, we used the PolyPhen-2 v2.2.3r406 [35] biotechnology tool to predict the functional consequence for rs736514667A/G variant which changes the encoded amino acid residue 30 of HNMT gene, replacing glutamine (Gln) by arginine (Arg). The polyphen-2 result reports using 2 different models (HumDiv and HumVar) predicted that the rs736514667A/G variant is probably damaging with a score of 0.991 (sensitivity: 0.71; specificity: 0.97) (HumDiv) and the same variant is possibly damaging with a score of 0.873 (sensitivity: 0.71; specificity: 0.89) (HumVar). These predictions of the functional consequence for rs73651 4667A/G variant confirms that rs736514667A/G might be a reasonable genetic marker for carnosine content in KNC-Rs. Additionally, we observed a significant association (p<0.05) between sex and carnosine content in KNC-Rs; females had higher breast-meat carnosine contents than males (Table 4). Because the genotyping of the HNMT-like missense SNP rs737657949A/C yielded a single genotype, AA, it could not be used for association studies.

DISCUSSION

HNMT and HNMT-like genes, influence the content of carnosine and anserine, respectively [27]. The present study validated the effects of these candidate genes on the carnosine and anserine contents in KNC-Rs. HNMT and HNMT-like are involved in histidine metabolism [27]. The content of flavor precursors in raw meat, including carnosine and anserine, influences the flavor of the cooked meat [913]. KNC-Rs have higher contents of flavor precursors such as carnosine compared to broilers or other KNC lines [2].
Carnosine is synthesized in muscles from L-histidine and β-alanine via carnosine synthase [20]; it can also be metabolized by carnosinase back into alanine and histidine [18]. HNMT-like catalyzes carnosine methylation to produce anserine [28,30]. Histidine and histamine are two metabolites of carnosine [36]. Histamine is synthesized from histidine via histidine decarboxylase [37] and is then degraded into N-methyl histamine by the enzyme HNMT [37]. Histamine acts as a neurotransmitter [38] and has effects on the immune system [37]. Moreover, histamine is an indicator of meat quality, freshness, and safety [39]. However, high amounts of histamine may be toxic, inducing allergy symptoms such as swelling, rash, hives, diarrhea, and headache [37,39,40]. Excess histamine is metabolized by either HNMT into N-methylhistamine or diamine oxidase into imidazole acetaldehyde [40,41]. Therefore, HNMT has a key role in histamine homeostasis to prevent the consequences of accumulated histamine in the body.
Genotyping of the HNMT gene for all five SNPs (one synonymous: rs29009298C/T; four missense: rs734406537G/A, rs736514667A/G, rs15881680G/A, and rs316765035T/C) yielded three genotypes (Table 2). Based on the χ2 results, all SNPs of HNMT were in HWE. This may be explained by the absence of evolutionary drivers in the sampled population [42]. Additionally, selection of KNC-Rs may have led to the fixation of one allele (A) for the missense SNP rs737657949A/C of HNMT-like. KNC-Rs with the homozygous genotype CC of the synonymous SNP rs29009298C/T had higher carnosine contents compared to those with the genotypes CT and TT. Moreover, KNC-Rs with the homozygous genotype AA had higher carnosine contents compared to those with the genotypes AG and GG for the HNMT missense SNP rs736514 667A/G. We also found a significant effect of sex on carnosine content in KNC-Rs; female chickens had higher carnosine contents in breast meat compared to males (Table 4). These results agreed with those of previous researchers who reported higher carnosine contents in female chickens compared with male chickens [2,43].
Carnosine influences meat quality traits such as redness and drip loss [24]. Moreover, carnosine and anserine are reportedly associated with the umami taste [25]. Thus, identifying SNPs and genotypes associated with higher carnosine and anserine contents is of major importance in the selection and breeding of chickens with desirable flavor qualities, which are typically related to healthier, stronger flavored meat. The limitation of our study was small sample size. Thus, the results (identification of the SNPs in HNMT gene and their association with the content of carnosine in KNC-Rs) of the current study must be validated in larger sample sizes of different populations, lines and chicken breeds.

CONCLUSION

Carnosine and anserine are one of the flavor precursors which affect the taste and flavor of the meat. Carnosine and anserine confer various health benefits to meat consumers. Our results confirmed the genetic effects of carnosine and identified SNPs in the HNMT gene of KNC-Rs that affect breast meat carnosine content. The homozygous genotype CC of the synonymous SNP rs29009298C/T was associated with a higher carnosine content compared to the genotypes CT and TTwhile genotype AA has a higher carnosine content compared to the genotypes AG and GG for the HNMT missense SNP rs736514667A/G. Moreover, the meat of female KNC-Rs contained higher carnosine contents compared to male chickens. The synonymous SNP rs29009298C/T and the missense SNP rs736514667A/G of the HNMT gene might be considered as potential genetic markers for the breeding of chickens with stronger flavored meat.

Notes

CONFLICT OF INTEREST

We certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript.

FUNDING

This study was financially supported by the project funding number: RS-2021-RD010125 (PJ016205) of the Rural Development Administration, South Korea.

Figure 1
RFLP genotyping results of HNMT (SNP rs29009298C/T, synonymous) visualized using 3% agarose gel electrophoresis from samples 1–7 (A); PACE genotyping results for missense variants of HNMT: rs734406537G/A (B); rs736514667A/G (C); rs15881680G/A (D); and rs316765035T/C (E). NEG, negative control; RFLP, restriction fragment length polymorphism; HNMT, Histamine-N-methyltransferase; SNP, single-nucleotide polymorphism; PACE, PCR allele competitive extension. DNA marker with 100 bp.
ab-23-0552f1.jpg
Table 1
Primers, genes, SNPs, PCR product (bp), annealing temperature, and genotyping method
Gene SNP/location Primer F/R Amplicon (bp) Annealing temperature (°C) Genotyping method
HNMT rs29009298C/T (synonymous) TATCCCTCAGAAACCAGTGG
GTTCTCACTGCATCCAGGCT
309 63 RFLP
rs734406537G/A (missense) Forward primer X, Y (5’-3’)
GAAGGTGACCAAGTTCATGCTGCTGACAGACCTCAGCCG/
GAAGGTCGGAGTCAACGGATTCCTGCTGACAGACCTCAGCCA
Common primer
AGACGTGGAAGCAGCGGACGTA
G/A (FAM/HEX)
NA 55 PACE
rs736514667A/G (missense) Forward primer X, Y (5’-3’)
GAAGGTGACCAAGTTCATGCTGGCCAAGTCTACTGAGCACCA/
GAAGGTCGGAGTCAACGGATTGGCCAAGTCTACTGAGCACCG
Common primer
CTGCTGCTCCACAAACTGCTTCAT
A/G (FAM/HEX)
NA 55 PACE
rs15881680G/A (missense) Forward primer X, Y (5’-3’)
GAAGGTGACCAAGTTCATGCTAGGAAAGGAAGACCCATACTTCC/
GAAGGTCGGAGTCAACGGATTGTAGGAAAGGAAGACCCATACTTCT
Common primer
CCTCAGAAACCAGTGGCTGGGAA
G/A (FAM/HEX)
NA 55 PACE
rs316765035T/C (missense) Forward primer X, Y (5’-3’)
GAAGGTGACCAAGTTCATGCTACAGATTCCTGCATTAGGAGACCTT/
GAAGGTCGGAGTCAACGGATTAGATTCCTGCATTAGGAGACCTC
Common primer
CACATCACTGTAGCAGCTTATAGATGTA
T/C (FAM/HEX)
NA 55 PACE
HNMT-like rs737657949A/C (missense) Forward primer X, Y (5’-3’)
GAAGGTGACCAAGTTCATGCTAGATGCTGTACCGTGTGGAAGATA/
GAAGGTCGGAGTCAACGGATTGATGCTGTACCGTGTGGAAGATC
Common primer
CTGTGGAAAAACTTGATGGTGTTAGGAA
A/C (FAM/HEX)
NA 55 PACE

SNPs, single-nucleotide polymorphisms; PCR, polymerase chain reaction; RFLP, restriction fragment length polymorphism; NA, not applicable; PACE, polymer chain reaction allele competitive extension.

Table 2
Genotype and allele frequencies, and HWE for HNMT and HNMT-like genes in KNC-Rs
Gene SNP Sample size Genotype frequency Allele frequency χ2 calc.1)
HNMT rs29009298C/T (synonymous) 384 CC (244) CT (131) TT (9) C T 3.2
0.64 0.34 0.02 0.80 0.20
rs734406537G/A (missense) 384 GG (155) AG (194) AA (35) G A 1.2
0.40 0.50 0.10 0.66 0.34
rs736514667A/G (missense) 384 AA (234) AG (138) GG (12) A G 2.45
0.61 0.36 0.03 0.79 0.21
rs15881680G/A (missense) 384 GG (225) AG (139) AA (20) G A 0.1
0.59 0.36 0.05 0.77 0.23
rs316765035T/C (missense) 384 TT (122) CT (192) CC (70) T C 0.15
0.32 0.50 018 0.57 0.43
HNMT-like (LOC771456) rs737657949A/C (missense) 384 AA AC CC A C NA
100 0 0 100 0

Individuals with specific genotypes are shown in parentheses.

HWE, Hardy–Weinberg equilibrium; HNMT, histamine-N-methyltransferase; KNC-R, red-brown Korean native chicken; NA, not applicable.

1) χ2 calc., chi-square calculated; χ2 table (p<0.05) = 3.84.

Table 3
Association of HNMT genotypes with carnosine and anserine contents in KNC-Rs
Gene SNP Trait (mg/100 g) Genotypes
CC (244) CT (131) TT (9)

HNMT rs29009298C/T (synonymous) Carnosine 283.44 ±56.3a 270.17±56.4b 238.28±34.78b
Anserine 721.60±74.9 739.80±69.02 741.27±62.77

GG (155) AG (195) AA (35)

rs734406537G/A (missense) Carnosine 279.34±60.91 277.60±57.32 262.37±51.86
Anserine 723.27±84.50 736.87±71.55 752.97±75.32

AA (234) AG (138) GG (12)

rs736514667A/G (missense) Carnosine 282.53±56.54a 267.04±56.65b 234.26±46.22b
Anserine 728.24±81.62 735.25±67.88 769.18±64.55

GG (225) AG (139) AA (20)

rs15881680G/A (missense) Carnosine 274.90±55.57 276.34±55.02 272.22±76.99
Anserine 726.62±78.57 733.86±81.02 738.22±64.65

TT (122) CT (192) CC (70)

rs316765035T/C (missense) Carnosine 277.81±57.22 278.28±59.40 267.79±50.76
Anserine 727.99±83.74 732.87±73.33 738.26±67.77

Individuals with specific genotypes are shown in parentheses.

The contents of carnosine and anserine are expressed as mg/100 g breast meat.

HNMT, histamine-N-methyltransferase; KNC-R, red-brown Korean native chicken; SNPs, single-nucleotide polymorphisms.

a,b Means within a row with different superscripts differ significantly at p<0.05.

Table 4
Effects of sex on carnosine and anserine contents in KNC-Rs
Sample size Trait Sex

Male (n = 192) Female (n = 192)
384 Carnosine 269.41±57.60b 286.11±54.42a
Anserine 721.16±65.50 735.67±79.43

Individuals with specific genotypes are shown in parentheses.

The contents of carnosine and anserine are expressed as mg/100 g breast meat.

KNC-R, red-brown Korean native chicken.

a,b Means within a row with different superscripts differ significantly at p<0.05.

REFERENCES

1. Petracci M, Cavani C. Muscle growth and poultry meat quality issues. Nutrients 2012;4:1–12. https://doi.org/10.3390/nu4010001
crossref pmid
2. Jung S, Bae YS, Kim HJ, et al. Carnosine, anserine, creatine, and inosine-5′-monophosphate contents in breast and thigh meats from 5 lines of Korean native chicken. Poult Sci 2013;92:3275–82. https://doi.org/10.3382/ps.2013-03441
crossref pmid
3. Cahyadi M, Park HB, Seo DW, et al. Association of the thyroid hormone responsive spot 14 alpha gene with growth-related traits in Korean native chicken. Asian-Australas J Anim Sci 2020;33:1755–62. https://doi.org/10.5713/ajas.19.0541
crossref pmid pmc
4. Kim M, Munyaneza JP, Cho E, et al. Genome-wide association study on the content of nucleotide-related compounds in Korean native chicken breast meat. Animals 2023;13:2966. https://doi.org/10.3390/ani13182966
crossref pmid pmc
5. Maltin C, Balcerzak D, Tilley R, Delday M. Determinants of meat quality: tenderness. Proc Nutr Soc 2003;62:337–47. https://doi.org/10.1079/PNS2003248
crossref pmid
6. Khan MI, Jo C, Tariq MR. Meat flavor precursors and factors influencing flavor precursors-a systematic review. Meat Sci 2015;110:278–84. https://doi.org/10.1016/j.meatsci.2015.08.002
crossref pmid
7. Ismail I, Joo ST. Poultry meat quality in relation to muscle growth and muscle fiber characteristics. Korean J Food Sci Anim Resour 2017;37:873–83. https://doi.org/10.5851/kosfa.2017.37.6.873
crossref pmid pmc
8. Munyaneza JP, Kim M, Cho E, Jang A, Choo HJ, Lee JH. Association of single-nucleotide polymorphisms in dual specificity phosphatase 8 and insulin-like growth factor 2 genes with inosine-5′-monophosphate, inosine, and hypoxanthine contents in chickens. Anim Biosci 2023;36:1357–66. https://doi.org/10.5713/ab.23.0080
crossref pmid pmc
9. Sasaki K, Motoyama M, Mitsumoto M. Changes in the amounts of water-soluble umami-related substances in porcine longissimus and biceps femoris muscles during moist heat cooking. Meat Sci 2007;77:167–72. https://doi.org/10.1016/j.meatsci.2007.02.025
crossref pmid
10. Jayasena DD, Ahn DU, Nam KC, Jo C. Factors affecting cooked chicken meat flavor: a review. Worlds Poult Sci J 2013;69:515–26. https://doi.org/10.1017/S0043933913000548
crossref
11. Jayasena DD, Kim SH, Lee HJ, et al. Comparison of the amounts of taste-related compounds in raw and cooked meats from broilers and Korean native chickens. Poult Sci 2014;93:3163–70. https://doi.org/10.3382/ps.2014-04241
crossref pmid
12. Hu J, Yu P, Ding X, Xu M, Guo B, Xu Y. Genetic polymorphisms of the AMPD1 gene and their correlations with IMP contents in Fast Partridge and Lingshan chickens. Gene 2015;574:204–9. https://doi.org/10.1016/j.gene.2015.08.008
crossref pmid
13. Uemoto Y, Ohtake T, Sasago N, et al. Effect of two non-synonymous ecto-5′-nucleotidase variants on the genetic architecture of inosine 5′-monophosphate (IMP) and its degradation products in Japanese Black beef. BMC Genomics 2017;18:874. https://doi.org/10.1186/s12864-017-4275-4
crossref pmid pmc
14. Jin S, Park HB, Seo D, et al. Identification of quantitative trait loci for the fatty acid composition in Korean native chicken. Asian-Australas J Anim Sci 2018;31:1134–40. https://doi.org/10.5713/ajas.17.0781
crossref pmid pmc
15. Shahidi F, Hossain A. Role of lipids in food flavor generation. Molecules 2022;27:5014. https://doi.org/10.3390/molecules27155014
crossref pmid pmc
16. Chumngoen W, Tan FJ. Relationships between descriptive sensory attributes and physicochemical analysis of broiler and Taiwan native chicken breast meat. Asian-Australas J Anim Sci 2015;28:1028–37. https://doi.org/10.5713/ajas.14.0275
crossref pmid pmc
17. Ma T, Xu L, Wang H, et al. Mining the key regulatory genes of chicken inosine 5′-monophosphate metabolism based on time series microarray data. J Anim Sci Biotechnol 2015;6:21. https://doi.org/10.1186/s40104-015-0022-3
crossref pmid pmc
18. Boldyrev AA, Aldini G, Derave W. Physiology and pathophysiology of carnosine. Physiol Rev 2013;93:1803–45. https://doi.org/10.1152/physrev.00039.2012
crossref pmid
19. Forsberg EA, Botusan IR, Wang J, et al. Carnosine decreases IGFBP1 production in db/db mice through suppression of HIF-1. J Endocrinol 2015;225:159–67. https://doi.org/10.1530/JOE-14-0571
crossref pmid
20. Blancquaert L, Baba SP, Kwiatkowski S, et al. Carnosine and anserine homeostasis in skeletal muscle and heart is controlled by β-alanine transamination. J Physiol 2016;594:4849–63. https://doi.org/10.1113/JP272050
crossref pmid pmc
21. Wu G. Important roles of dietary taurine, creatine, carnosine, anserine and 4-hydroxyproline in human nutrition and health. Amino Acids 2020;52:329–60. https://doi.org/10.1007/s00726-020-02823-6
crossref pmid pmc
22. Teeravirote K, Sutthanut K, Thonsri U, et al. Anserine/Carnosine-rich extract from Thai native chicken suppresses melanogenesis via activation of ERK signaling pathway. Molecules 2022;27:7440. https://doi.org/10.3390/molecules27217440
crossref pmid pmc
23. D'Astous-Pagé J, Gariépy C, Blouin R, et al. Identification of single nucleotide polymorphisms in carnosine-related genes and effects of genotypes on pork meat quality attributes. Meat Sci 2017;134:54–60. https://doi.org/10.1016/j.meatsci.2017.07.019
crossref pmid
24. Ma XY, Jiang ZY, Lin YC, Zheng CT, Zhou GL. Dietary supplementation with carnosine improves antioxidant capacity and meat quality of finishing pigs. J Anim Physiol Anim Nutr (Berl) 2010;94:e286–95. https://doi.org/10.1111/j.1439-0396.2010.01009.x
crossref pmid
25. Dashdorj D, Amna T, Hwang I. Influence of specific taste active components on meat flavor as affected by intrinsic and extrinsic factors: an overview. Eur Food Res Technol 2015;241:157–71. https://doi.org/10.1007/s00217-015-2449-3
crossref
26. Zhang L, Hao Z, Zhao C, et al. Taste compounds, affecting factors, and methods used to evaluate chicken soup: a review. Food Sci Nutr 2021;9:5833–53. https://doi.org/10.1002/fsn3.2501
crossref pmid pmc
27. Kim M, Munyaneza JP, Cho E, et al. Genome-wide association studies of anserine and carnosine contents in the breast meat of Korean native chickens. Poult Sci 2024;103:103590. https://doi.org/10.1016/j.psj.2024.103590
crossref pmid pmc
28. Drozak J, Chrobok L, Poleszak O, Jagielski AK, Derlacz R. Molecular identification of carnosine N-methyltransferase as chicken histamine N-methyltransferase-like protein (hnmt-like). PLoS One 2013;8:e64805. https://doi.org/10.1371/journal.pone.0064805
crossref pmid pmc
29. Kwiatkowski S, Kiersztan A, Drozak J. Biosynthesis of carnosine and related dipeptides in vertebrates. Curr Protein Pept Sci 2018;19:771–89. https://doi.org/10.2174/1389203719666180226155657
crossref pmid
30. Andersen SM, Waagbø R, Espe M. Functional amino acids in fish health and welfare. Front Biosci (Elite Ed) 2016;8:143–69. https://doi.org/10.2741/757
crossref pmid
31. Kim HC, Ko YJ, Jo C. Potential of 2D qNMR spectroscopy for distinguishing chicken breeds based on the metabolic differences. Food Chem 2021;342:128316. https://doi.org/10.1016/j.foodchem.2020.128316
crossref pmid
32. Nei M, Kumar S. Molecular evolution and phylogenetics. New York, USA: Oxford University Press; 2000. p. 231–5.
crossref
33. Hartl DL, Clark AG. Principle of population genetics. 4th edSunderland, MA, USA: Sinauer Associates; 1997. p. 81
crossref
34. R Core Team. R: a language and environment for statistical computing [Internet]. Vienna, Austria: R foundation for statistical computing; 2022. [cited 2023 Nov 20]. Available from: https://www.R-project.org/
crossref
35. Adzhubei IA, Schmidt S, Peshkin L, et al. A method and server for predicting damaging missense mutations. Nat Methods 2010;7:248–9. https://doi.org/10.1038/nmeth0410-248
crossref pmid pmc
36. Dai YJ, Wu DC, Feng B, et al. Protective effect of carnosine on febrile seizures in immature mice. Neurosci Lett 2015;588:95–100. https://doi.org/10.1016/j.neulet.2014.12.061
crossref pmid
37. Huang H, Li Y, Liang J, Finkelman FD. Molecular regulation of histamine synthesis. Front Immunol 2018;9:1392. https://doi.org/10.3389/fimmu.2018.01392
crossref pmid pmc
38. Wójcik W, Łukasiewicz-Mierzejewska M, Damaziak K, Bień D. Biogenic amines in poultry meat and poultry products: formation, appearance, and methods of reduction. Animals 2022;12:1577. https://doi.org/10.3390/ani12121577
crossref pmid pmc
39. Michalski M, Pawul-Gruba M, Madejska A. Histamine contents in raw long-ripening meat products commercially available in Poland. J Vet Res 2021;65:477–81. https://doi.org/10.2478/jvetres-2021-0062
crossref pmid pmc
40. Maintz L, Novak N. Histamine and histamine intolerance. Am J Clin Nutr 2007;85:1185–96. https://doi.org/10.1093/ajcn/85.5.1185
crossref pmid
41. Neumann J, Grobe JM, Weisgut J, et al. Histamine can be formed and degraded in the human and mouse heart. Front Pharmacol 2021;12:582916. https://doi.org/10.3389/fphar.2021.582916
crossref pmid pmc
42. Allendorf FW, Luikart G, Aitken SN. Conservation and genetics of populations. 2nd edHoboken, NJ, USA: John Wiley and Sons; 2013. p. 118–32.
crossref
43. Suwanvichanee C, Sinpru P, Promkhun K, et al. Effects of b-alanine and L-histidine supplementation on carnosine contents in and quality and secondary structure of proteins in slow-growing Korat chicken meat. Poult Sci 2022;101:101776. https://doi.org/10.1016/j.psj.2022.101776
crossref pmid pmc


Editorial Office
Asian-Australasian Association of Animal Production Societies(AAAP)
Room 708 Sammo Sporex, 23, Sillim-ro 59-gil, Gwanak-gu, Seoul 08776, Korea   
TEL : +82-2-888-6558    FAX : +82-2-888-6559   
E-mail : editor@animbiosci.org               

Copyright © 2026 by Asian-Australasian Association of Animal Production Societies.

Developed in M2PI

Close layer
prev next