The MAC-T cell were cultured in the growth medium: Dulbecco’s modified Eagle medium (Hyclone, Logan, UT, USA) supplemented with 10% fetal bovine serum (Hyclone, USA), 1% penicillin/streptomycin (Hyclone, USA) and 0.05% gentamicin (Sigma-Aldrich Inc., St. Louis, MO, USA). MAC-T cells were seeded at a density of 1.75×10⁵ cells per well into 12-well plates (SPL, Gyeonggi, Pocheon, Korea) or 3.0×10⁵ cells per well into 6-well plates (SPL, Korea) and incubated at 37°C with 5% CO₂. The culture medium was replaced with 0.5 or 1 mL of fresh media before transfection. Thereafter, the cells were co-transfected with circular hLF knock-in vector II (1.25 or 2 μg), CRISPR-sgRNA expression vector (0.625 or 1 μg) and overexpression vectors of DNA DSB repair-related genes (bRAD51, bCHK1, or bCHK2) (0.625 or 1 μg) using Xfect transfection reagent (Takara, Tokyo, Japan) according to the manufacturer’s instructions. Totally, 2.5 or 5 μg of DNA was added to each well and the total volume was made up to 50 or 100 μL with Xfect reaction buffer, followed by the addition of 0.75 or 1.5 μL of Xfect polymer. After 24 hours of transfection, the treatment groups were treated with 1, 10, or 25 μM CdCl₂ and the medium was replaced with fresh medium the next day. Cells were incubated for further 48 hours, followed by the extraction of genome DNA from the transfected cells using the G-DEX IIc genomic DNA extraction kit (for cell/tissue) (Intron, Seongnam-si, Korea) according to the manufacturer’s instructions.

To construct the knock-in vector II, we first modified the 3′ homology arm of pBSK(−)m_RG1_1 l kb 5′ arm_hLF_BGHpolyA_EGFP_BGHpolyA _2 kb 3′ arm, termed hLF knock-in vector I, which contains approximately 2 kb homology arm at 3′ site and was previously reported by Kim et al [20]. The 3′ arm used for knock-in vector was amplified by polymerase chain reaction (PCR) from genome DNA of MAC-T cells. The 1 kb 3′ arm fragment is homologous to a region of exon 3 in the β-casein gene and starts exactly from the Cas9/sgRNA cleavage site, which was previously reported by Jeong et al [21]. PCR was performed using the bβCE3 II S primer (AAGCTTACCTGGTGAGGTAAGATATTTTTAT) and the bβCE3 1kbPHR II AS primer (GTCGACCAGAT TTAGGACTACACTCA), containing HindIII and SalI restriction enzyme sites using KOD FX Neo (Toyobo, Osaka, Japan). The purified PCR fragment was sub-cloned into pGEM-T easy vector (Promega, Madison, WI, USA) and the primary structure of the fragment was confirmed via sequencing using T7 and SP6 primers. Finally, to construct the knock-in vector II, the pGEM T-easy_β-casein exon 3 3′ arm plasmid was digested by Hind III and Sal I enzymes to obtain the bβCE3 3′ arm. The fragment was then inserted into the Hind III-Sal I site of pBSK(−)m_RG1_1 kb 5′ arm_hLF_BGHpolyA_EGFP_BGHpolyA_2 kb 3′ arm plasmid to produce pBSK(−)m_RG1_1 kb 5′ arm_hLF_BGHpolyA_EGFP_BGHpolyA_1 kb 3′ arm plasmid, designated as hLF knock-in vector II.

Knock-in efficiency of hLF knock-in vector in MAC-T cells was confirmed by first and second PCRs. The genome DNA from each group was used as a DNA template for PCR. The first PCR was performed with RG1_hLF 5sc S1 primer (GC TCCTCCTTCACTTCTTGTCCTCTACTTT) and hLFsc AS1 primer (AACTCACTATTATGCCGTGGCTGTGGT GAA), harboring outside of 5′ arm and hLF gene each in hLF knock-in vector II using KOD FX Neo (Toyobo, Japan). The PCR entailed denaturation at 95°C for 15 minutes, followed by 25 cycles of amplification at 95°C for 20 seconds, annealing at 66°C for 40 seconds, strand extension at 72°C for 2.5 minutes, and a final elongation step at 72°C for 5 minutes. Then, the second PCR was carried out using the RG1_hLF 5sc S4 primer (CAAATTACGAATTAGCATC CATGAGAAAAA) and the hLFsc AS4 primer (CTTGTC TTCCTCG TCCTGCTGTTCCTCGGG) using KOD FX Neo (Toyobo, Japan) as follows: denaturation at 95°C for 15 minutes, followed by 30 cycles of amplification at 95°C for 20 seconds, annealing at 58°C for 40 seconds, strand extension at 72°C for 1.5 minutes, and a final elongation step at 72°C for 5 minutes. The PCR fragments were confirmed by electrophoresis on a 0.8% agarose gel. For comparative quantification, each DNA band was normalized to the bβCE7 region.

Total RNA from MAC-T cells was isolated using RNeasy mini kit (QIAGEN, Hilden, Germany). Next, for cDNA synthesis, 2 μg of total RNA was used as a template and RT-PCR was performed using random primers and Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. Quantitative real-time PCR (RT-qPCR) was carried out to measure the mRNA expression of RAD51 and DNA MMR-related genes in a total volume of 20 μL, containing 20 ng cDNA, 10 pmol of forward and reverse primer pairs (Table 1), and 10 μL of TOPreal qPCR 2X PreMIX (Enzynomics, Daejeon, Korea). All reactions were repeated three times and were run by Mx3000P (Agilent Technologies, Santa Clara, CA, USA) under the following conditions: denaturation at 95°C for 10 minutes, followed by 40 cycles of amplification at 95°C for 10 seconds, annealing at 60°C for 15 seconds, and strand extension at 72°C for 15 seconds. For comparative quantification, mRNA expression levels of each gene were normalized to the mouse Rplp0 transcript.

Protein from MAC-T cells was extracted using PRO-PREP protein extraction solution (Intron, Korea) according to the manufacturer’s instructions. Protein extracts (50 μg) derived from the cells were resolved by 8% or 12% Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) at 60 mA for 1.5 hours and electroblotted onto polyvinylidene fluoride membranes for protein blotting (Bio-Rad Co., Hercules, CA, USA) at 80 V for 2 hours in a trans-blot apparatus (Bio-Rad Co., USA) using Tris-glycine buffer. After blocking the membrane for 1 hour at room temperature in 5% skim milk in Tris-buffered saline with 0.1% Tween 20 (TBST), the blot was probed with rabbit polyclonal anti-MSH2 antibody (Abcam, Cambridge, UK) at a dilution of 1:5,000 or mouse monoclonal anti-RAD51 antibody (Santa Cruz Biotechnology, Dallas, TX, USA) at a dilution of 1:1,000 in 5% skim milk in TBST overnight at 4°C. After overnight incubation, the membrane was washed with TBST three times and incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin G (IgG) or HRP-conjugated goat anti-mouse IgG at a dilution of 1:1,000 in 5% skim milk in TBST at room temperature for 2 hours. The membrane was washed three times with TBST, and MSH2 and RAD51 proteins were detected using EZ-Western Lumi Pico Kit and EZ-Western Lumi Femto Kit (Dogen, Seoul, Korea). To remove bound antibody and facilitate the reuse of the blot, the membrane was incubated in SDS/β-mercaptoethanol solution at 55°C for 20 minutes. The antibody was stripped off, and the membrane was washed three times with TBST, followed by steps as described in the western blot protocol above. The blot was re-probed with mouse monoclonal β-actin antibody (Santa Cruz Biotechnology, USA) at a dilution of 1:1,000 in 5% skim milk in TBST, following blocking at 4°C overnight. The membrane was then washed with TBST three times and incubated with HRP-conjugated goat anti-mouse IgG at a dilution of 1:2,000 in 5% skim milk in TBST at room temperature for 2 hours. After membrane was washed three times with TBST, β-actin protein was detected using EZ-Western Lumi Pico Kit (Dogen, Korea). For comparative quantification of protein levels, RAD51 and MSH2 protein bands were normalized to β-actin, respectively.

Densitometric quantification of DNA or protein bands was performed by analyzing each data using UN-SCAN-IT gel Analysis Software (Silk Scientific Inc., Orem, UT, USA). Subsequently, a statistical analysis of the mRNA levels and densitometric quantification of DNA and protein bands was performed with GraphPad Prism 5 (GraphPad Software Inc., San Diego, CA, USA). The data were analyzed in either of the two ways. First, the data were analyzed with one-way analysis of variance, followed by Dunnett test. This method was used to compare all columns with reference to the control column. Second, a t-test was used for comparison of differences between the two columns. The confidence interval was set to 95%.

The knock-in vector was constructed for expression of the bovine β-casein fused hLF gene in the bovine mammary gland as shown in the schematic diagram (Figure 1). The knock-in vector is composed of a 5′ homology arm, hLF gene, BGH poly A signal, cytomegalovirus-enhanced green flurescent protein (CMV-EGFP) gene and 3′ homology arm. Poly A signal was attached to stabilize the expression of foreign genes. EGFP gene was used as a positive selection marker to visualize the expression of the knock-in vector in the cells. The knock-in vector was designed to carry a 3′ arm that was homologous to an exon 3 region in the bovine β-casein gene locus and starting exactly at the cleavage site by CRISPR-sgRNA system targeting β-casein exon 3. If the knock-in vector undergoes HR in the bovine β-casein gene locus, hLF can be expressed under the control of β-casein promoter and gene regulatory sequences.

To determine whether CdCl₂ treatment affected cell viability in MAC-T cells, we treated the cells with different concentrations of CdCl₂. In response to CdCl₂ treatment, MAC-T cell viability ratios were increased at 1 and 10 μM (114.05% and 131.38% each) and decreased at 25 μM (94.08%) compared with the untreated control (Figure 2A). No viable cells were found at 50 μM (data not shown). Statistical analysis did not reveal any notable differences between the groups. Next, the impact of CdCl₂ concentration on knock-in efficiency in MAC-T cells was analyzed by transfecting the cells with hLF knock-in vector II and CRISPR-sgRNA expression vector, followed by treatment with CdCl₂ (0 to 25 μM). As a result, the knock-in efficiency in the presence of CRISPR-sgRNA expression vector was significantly higher than in the absence of the expression vector. However, no detectable change in knock-in efficiency was observed between the CdCl₂ treatment groups (Figure 2B). Based on these results, the cells were treated with 1 μM CdCl₂ in subsequent experiments to minimize cell death and mutation rate.

Next, to determine whether the treatment times of CdCl₂ affected the mRNA levels of RAD51 and DNA MMR-related genes, MAC-T cells were treated with 1 μM CdCl₂ for 3 days and the total RNA was extracted daily. As indicated in Figure 2C, our experiments detected decreased levels of mRNA expression in MutSα (MSH2 and MSH6) and MutLα (MLH1 and PMS2) homologs, and RAD51 by increasing the duration of CdCl₂ treatment. Compared with the control, the mRNA levels of MSH2 and MSH6 on day 3 were decreased by 36%, MLH1 was decreased by 29%, and PMS2 was decreased by 66%. In contrast, MSH3 mRNA levels were increased on day 1 and decreased on day 2 and 3, but were slightly higher than the control levels (1.2-fold).

To determine the influence of different treatment times of CdCl₂ on the expression of MSH2 and RAD51 proteins, a western blot was carried out and normalized to β-actin. Compared with the control, the levels of MSH2 protein were increased on day 1 and 2 (1.2-fold and 3.3-fold, respectively) and decreased on day 3 (Figure 2D). Moreover, the expression of RAD51 protein was increased on day 1 and 2 (1.22-fold and 2.32-fold, respectively) compared with the control, and decreased on day 3 (Figure 2E). However, no significant difference was observed between day 0 and 3. Consequently, CdCl₂ treatment decreased the mRNA levels of DNA MMR-related genes but did not decrease the expression of MSH2 protein.

To determine whether overexpression of RAD51 gene increases the knock-in efficiency by enhancing HR, MAC-T cells were transfected with hLF knock-in vector II, CRISPR-sgRNA expression vector and RAD51 overexpression vector. As a result, the mRNA (Figure 3A) and protein (Figure 3B) levels of RAD51 were significantly up-regulated. Also, the knock-in efficiency in the presence of CRISPR-sgRNA expression vector was higher than in the group without the expression vector. However, the overexpression of RAD51 gene did not enhance knock-in efficiency (Figure 3C). Thus, to investigate whether DNA MMR-related genes affected RAD51 gene, the mRNA levels of MMR-related genes were assessed by real-time qPCR. The results showed that MLH1 mRNA levels were slightly increased by RAD51 overexpression (1.23-fold), but other MutS and MutL homologs had no significant change (Figure 3D).

To determine whether RAD51 overexpression and down-regulation of DNA MMR-related genes increases the knock-in efficiency in MAC-T cells, cells overexpressing RAD51 gene were treated with 1 μM CdCl₂. As a result, RAD51 expression was decreased by CdCl₂ treatment (Figure 4A). Also, the knock-in efficiency in the presence of CRISPR-sgRNA expression vector was higher than in the group without the expression vector. However, no significant difference was observed among the groups (Figure 4B). Next, the mRNA levels of DNA MMR-related genes were analyzed via RT-qPCR. As indicated in Figure 4C, increased MSH3 mRNA levels were observed (1.5-fold), but there was no significant difference in other DNA MMR-related genes in MAC-T cells overexpressing RAD51 gene and treated with 1 μM CdCl₂. All things considered, RAD51 overexpression and treatment with 1 μM CdCl₂ did not increase the knock-in efficiency in MAC-T cells. Further, the mRNA levels of DNA MMR-related genes showed no significant difference.

In order to determine whether the overexpression of CHK1 gene can increase the knock-in efficiency by stimulating RAD51 gene, MAC-T cells were transfected with hLF knock-in vector II, CRISPR-sgRNA expression vector and RAD51 overexpression vector. As a result, the CHK1 mRNA levels were up-regulated by CHK1 overexpression vector (3-fold) (Figure 5A). Also, the knock-in efficiency in the presence of CRISPR-sgRNA expression vector was higher than in the group without the expression vector. However, overexpression of CHK1 gene did not increase the knock-in efficiency in MAC-T cells (Figure 5B). Next, the analysis of the mRNA levels of RAD51 and DNA MMR-related genes via RT-qPCR showed no significant change in RAD51 and DNA MMR-related genes following CHK1 overexpression (Figure 5C).

To determine whether overexpression of CHK2 gene increases HR-mediated knock-in efficiency in MAC-T cells by stimulating RAD51 gene, the MAC-T cells were transfected with hLF knock-in vector II, CRISPR-sgRNA expression vector and CHK2 overexpression vector. First, it was observed that the mRNA levels of CHK2 gene were up-regulated by CHK2 overexpression vector (20-fold) (Figure 6A). Also, the knock-in efficiency in the presence of CRISPR-sgRNA expression vector was higher than in the absence of the expression vector. However, the overexpression of CHK2 gene did not increase the knock-in efficiency in MAC-T cells (Figure 6B). Next, the analysis of the mRNA levels of RAD51 and DNA MMR-related genes by RT-qPCR revealed a decrease in the mRNA levels of RAD51 gene by 30% and a slight increase in MSH6 by 1.13-fold, but no significant difference was observed in other MutS and MutL homologs (Figure 6C).