Anim Biosci > Volume 31(5); 2018 > Article |
|
Marker name | Location1) | Region | Primer (Forward/Reverse) (5′-3′) | Restriction enzyme | Amplicon (bp) |
---|---|---|---|---|---|
M_1 | g.6758T>C | Exon 5 |
AGTATAGCTCTGTGGTGCAC TATGCCCTCAGATGTCCCAG |
HhaI | 626 |
M_2 | g.9432T>C | Intron 5 |
GGGGATTTTGCCACTTTAGGG TGGGTAAGGCTCTGGCACTGT |
EcoRI | 442 |
M_3 | g.11041T>C | Exon 6 |
GGGGTACCACTCAACTTCAG TAGGGTACCTGCAATGGGGG |
BspHI | 750 |
Item | Genotype frequency | Allele frequency | χ2 test2) | ||||
---|---|---|---|---|---|---|---|
|
|
|
|||||
CC | CT | TT | C | T | χ2 | p<0.005 | |
M_1 | 0.858 | 0.101 | 0.041 | 0.908 | 0.092 | 85.92 | 0.000 |
M_2 | 0.868 | 0.110 | 0.022 | 0.923 | 0.077 | 27.84 | 1.316e-7 |
M_3 | 0.844 | 0.130 | 0.026 | 0.909 | 0.091 | 23.82 | 1.059e-06 |
Trait1) | Genotype of M_2 | p-value | Effect | |||
---|---|---|---|---|---|---|
|
|
|||||
CC(507) | CT(64) | TT(13) | Additive | Dominance | ||
BW02 (g) | 142.41±1.13a | 134.70±2.27b | 143.68±4.42a | 0.032 | 7.89 | −8.345 |
GR0–2 (g) | 103.66±1.07a | 96.59±2.64b | 106.37±3.60a | 0.008 | 2.73 | −8.425 |
GR16–18 (g) | 218.04±5.10a | 178.95±24.0b | 148.56±22.3b | 0.016 | −28.80 | −0.042 |
α (g) | 7.679±0.018 | 7.598±0.077 | 7.598±0.077 | 0.062 | - | - |
|
||||||
Genotype of M_3 | ||||||
|
||||||
CC(493) | CT(76) | TT(15) | ||||
|
||||||
GR0–2 (g) | 103.48±1.07 | 98.52±2.67 | 105.21±4.30 | 0.081 | - | - |
GR14–16 (g) | 217.93±3.53a | 182.78±8.51ab | 174.57±17.8b | 0.043 | −11.95 | −13.47 |
GR16–18 (g) | 217.93±5.10b | 185.32±224.70b | 162.97±20.50a | 0.040 | −24.95 | −5.13 |
γ (wk) | 0.228±0.001 | 0.239±0.003 | 0.228±0.006 | 0.066 | - | - |
α (g) | 7.684±0.018ab | 7.599±0.36b | 7.598±0.077b | 0.030 | −0.095 | −0.04 |
1) BW, body weight at 2 weeks; GR0–2, weight gain from 0 to 2 weeks; GR14–16, weight gain from 14 to 16 weeks; GR16–18, weight gain from 16 to 18 weeks; α, asymptotic final body weight (g); γ, constant scale that is proportional to the overall growth rate (Numbers in bracket refer to sample size for each genotype).
Association of HNMT gene polymorphisms with carnosine content in red-brown Korean native chickens