Item | CON1) | CF2) | IRS-CS3) |
---|---|---|---|
Ingredient (% dry matter) | |||
Oat hay | 21.09 | 6.91 | - |
Timothy hay | 9.26 | 7.28 | - |
Alfalfa hay | 13.95 | 7.31 | - |
Corn silage | - | 4.77 | 9.11 |
Italian ryegrass silage | - | 19.07 | 36.43 |
Corn gluten feed | 12.83 | 12.59 | 12.54 |
Lupin seed | 10.94 | 10.74 | 10.70 |
Wheat bran | 12.45 | 12.22 | 12.17 |
Corn | 17.33 | 17.01 | 16.95 |
Vitamin-mineral supplement4) | 0.69 | 0.67 | 0.67 |
Limestone | 1.23 | 1.21 | 1.20 |
Salt | 0.24 | 0.24 | 0.23 |
1) CON, total mixed ration with oat hay, timothy, and alfalfa hay as roughage source (imported forage).
2) CF, total mixed ration with oat hay, timothy, alfalfa hay, corn silage, and Italian ryegrass silage as roughage source (combined forage of imported and domestic source).
Target | Primer sequence (5′ → 3′) | Reference |
---|---|---|
General bacteria | Forward: CGGCAACGAGCGCAACCC | [44] |
Reverse: CCATTGTAGCACGTGTGTAGCC | ||
Protozoa | Forward: GCTTTCGWTGGTAGTGTATT | [45] |
Reverse: CTTGCCCTCYAATCGTWCT | ||
General anaerobic fungi | Forward: GAGGAAGTAAAAGTCGTAACAAGGTTTC | [44] |
Reverse: CAAATTCACAAAGGGTAGGATGATT | ||
Lactobacillus spp. | Forward: CTCAAAACTAAACAAAGTTTC | [46] |
Reverse: CTTGTACACACCGCCCGTCA | ||
Bacillus spp. | Forward: GGCTCACCAAGGCAACGAT | [47] |
Reverse: GGCTGCTGGCACGTAGTTAG | ||
Fibrobacter succinogenes | Forward: GTTCGGAATTACTGGGCGTAAA | [44] |
Reverse: CGCTGCCCCCTGAACTATC | ||
Ruminococcus flavefaciens | Forward: CGAACGGAGATAATTTGAGTTTACTTAGG | [45] |
Reverse: CGGTCTCTGTATGTTATGAGGTATTACC |
Parameters | TMR treatments1) | SEM | p-values2) | |||||||
---|---|---|---|---|---|---|---|---|---|---|
|
||||||||||
CON | CF | IRS-CS | ||||||||
|
|
|
|
|||||||
NF | F | NF | F | NF | F | Forage | Type | F×T | ||
Fermentation profile | ||||||||||
pH | 6.84c | 5.17d | 8.13b | 4.82f | 8.19a | 4.91e | 0.0090 | <0.0001 | <0.0001 | <0.0001 |
Lactate (mM) | 19.11cd | 22.96bc | 12.86d | 36.25a | 13.33cd | 32.74ab | 2.2541 | 0.4908 | <0.0001 | 0.0014 |
Acetate (mM) | 7.37 | 12.67 | 8.18 | 12.53 | 10.31 | 17.99 | 1.2484 | 0.0109 | 0.0001 | 0.4161 |
Propionate (mM) | 5.63 | 1.34 | 5.67 | 2.88 | 5.47 | 1.75 | 0.6990 | 0.5015 | <0.0001 | 0.5714 |
Butyrate (mM) | 1.95 | 2.14 | 2.42 | 2.40 | 2.62 | 2.51 | 0.1985 | 0.0572 | 0.9145 | 0.7432 |
NH3-N (mg/dL) | 0.03 | 1.34 | 2.89 | 4.46 | 3.35 | 4.85 | 0.1255 | <0.0001 | <0.0001 | 0.5651 |
Chemical composition (% DM) | ||||||||||
Moisture | 27.40d | 29.74c | 39.21a | 38.61ab | 37.01b | 40.17a | 0.3380 | <0.0001 | 0.0010 | 0.0033 |
CP | 12.91a | 12.37a | 8.59c | 10.25b | 9.44bc | 10.09b | 0.1956 | <0.0001 | 0.0102 | 0.0041 |
EE | 0.91b | 0.96b | 0.69b | 1.34a | 0.70b | 1.42a | 0.0590 | 0.2067 | <0.0001 | 0.0025 |
CF | 18.72a | 16.48b | 14.70c | 13.51d | 16.07b | 13.26d | 0.1488 | <0.0001 | <0.0001 | 0.0045 |
Ash | 4.83cd | 4.82d | 5.55a | 5.15b | 5.11bc | 5.07bcd | 0.0509 | 0.0002 | 0.0100 | 0.0155 |
NDF | 40.32 | 40.29 | 41.37 | 41.35 | 41.40 | 41.38 | 0.0455 | <0.0001 | 0.3226 | 0.8481 |
ADF | 23.15 | 23.10 | 22.95 | 22.87 | 23.23 | 23.22 | 0.1180 | 0.0890 | 0.6454 | 0.9570 |
Microbial profile (log10 cfu/g FM) | ||||||||||
LAB | ND | 6.48 | 6.34 | 7.88 | 6.50 | 8.04 | 0.1635 | <0.0001 | <0.0001 | 0.9841 |
Yeast | ND | 2.25 | 2.23 | 2.28 | 2.25 | 2.31 | 0.0420 | 0.6118 | 0.2466 | 0.9691 |
Mold | ND | ND | ND | ND | ND | ND | - | - | - | - |
TMR, total mixed ration; SEM, standard error of the mean; DM, dry matter; CP, crude protein; EE, ethyl extract; CF, crude fiber; NDF, neutral detergent fiber; ADF, acid detergent fiber; FM, fresh matter; LAB, Lactic acid bacteria; ND, not detected.
1) TMR treatments: CON, total mixed ration with oat hay, timothy, and alfalfa hay as roughage source (imported forage); CF, total mixed ration with oat hay, timothy, alfalfa hay, corn silage, and Italian ryegrass silage as roughage source (combined forage of imported and domestic source); IRS-CS, total mixed ration with Italian ryegrass silage and corn silage as roughage source (domestic forage). TMR group: NF, non-fermented TMR; F, fermented TMR.
Parameters | Time (h) | TMR treatments1) | SEM | p-values2) | |||||||
---|---|---|---|---|---|---|---|---|---|---|---|
|
|||||||||||
CON | CF | IRS-CS | |||||||||
|
|
|
|
||||||||
NF | F | NF | F | NF | F | Forage | Type | F×T | |||
Total gas (mL) | 6 | 12.00 | 23.67 | 17.00 | 27.04 | 19.33 | 26.67 | 0.8819 | 0.0002 | <0.0001 | 0.0837 |
12 | 22.33 | 37.00 | 21.67 | 37.00 | 23.33 | 38.33 | 1.2766 | 0.4883 | <0.0001 | 0.9666 | |
24 | 38.33 | 49.00 | 43.33 | 57.67 | 44.00 | 58.67 | 2.1645 | 0.0075 | <0.0001 | 0.6042 | |
pH | 6 | 6.53 | 6.50 | 6.55 | 6.49 | 6.55 | 6.49 | 0.0081 | 0.9184 | <0.0001 | 0.0784 |
12 | 6.42bc | 6.40c | 6.48a | 6.38c | 6.45ab | 6.38c | 0.0115 | 0.1320 | <0.0001 | 0.0184 | |
24 | 6.30bc | 6.26d | 6.35a | 6.27cd | 6.30b | 6.27cd | 0.0068 | 0.0024 | <0.0001 | 0.0041 | |
NH3-N (mg/dL) | 6 | 11.60 | 11.12 | 8.78 | 12.61 | 9.07 | 11.80 | 1.0563 | 0.6726 | 0.0367 | 0.1479 |
12 | 11.82 | 10.43 | 11.70 | 11.53 | 11.72 | 12.76 | 0.4839 | 0.114 | 0.6747 | 0.0803 | |
24 | 14.49 | 15.19 | 10.47 | 15.08 | 13.45 | 17.97 | 0.8213 | 0.0108 | 0.0004 | 0.0562 |
TMR, total mixed ration; SEM, standard error of the mean; NH3-N, ammonia-nitrogen; ND, not detected.
1) TMR treatments: CON, total mixed ration with oat hay, timothy, and alfalfa hay as roughage source (imported forage); CF, total mixed ration with oat hay, timothy, alfalfa hay, corn silage, and Italian ryegrass silage as roughage source (combined forage of imported and domestic source); IRS-CS, total mixed ration with Italian ryegrass silage and corn silage as roughage source (domestic forage). TMR group: NF, non-fermented TMR; F, fermented TMR.
Parameters | Time (h) | TMR treatments1) | SEM | p-values2) | |||||||
---|---|---|---|---|---|---|---|---|---|---|---|
|
|||||||||||
CON | CF | IRS-CS | |||||||||
|
|
|
|
||||||||
NF | F | NF | F | NF | F | Forage | Type | F×T | |||
Acetate (mM) | 6 | 38.89c | 42.53b | 36.77c | 43.71cb | 38.22c | 44.77a | 0.4682 | 0.0571 | <0.0001 | 0.0080 |
12 | 47.36bc | 48.91ab | 43.49d | 50.95a | 45.95c | 51.01a | 0.4676 | 0.0505 | <0.0001 | 0.0001 | |
24 | 58.85a | 60.27a | 52.05b | 60.23a | 55.05b | 59.46a | 0.6633 | 0.0008 | <0.0001 | 0.0010 | |
Propionate (mM) | 6 | 13.18c | 14.55b | 12.25c | 14.93ab | 12.40c | 15.86a | 0.2634 | 0.1682 | <0.0001 | 0.0062 |
12 | 16.55bc | 18.33ab | 14.71d | 18.59a | 16.29cd | 18.31ab | 0.3872 | 0.1340 | <0.0001 | 0.0363 | |
24 | 20.14bc | 21.15ab | 17.98d | 22.01a | 18.81cd | 20.97ab | 0.3425 | 0.0991 | <0.0001 | 0.0029 | |
Butyrate (mM) | 6 | 7.69 | 8.62 | 7.52 | 8.69 | 7.76 | 8.26 | 0.1555 | 0.6419 | <0.0001 | 0.1368 |
12 | 9.68ab | 9.63ab | 9.31b | 9.83a | 9.43ab | 9.84a | 0.1082 | 0.7089 | 0.0060 | 0.0489 | |
24 | 12.84 | 14.41 | 12.09 | 13.81 | 14.06 | 14.10 | 0.8220 | 0.4134 | 0.1254 | 0.5472 | |
A/P ratio | 6 | 2.95 | 2.93 | 3.00 | 2.93 | 3.08 | 2.83 | 0.0563 | 0.9162 | 0.0238 | 0.1395 |
12 | 2.87 | 2.67 | 2.96 | 2.74 | 2.82 | 2.79 | 0.0527 | 0.3306 | 0.0049 | 0.2080 | |
24 | 2.92 | 2.85 | 2.90 | 2.74 | 2.93 | 2.84 | 0.0605 | 0.4342 | 0.0476 | 0.7517 | |
Total VFA (mM) | 6 | 59.75b | 65.69a | 56.54b | 67.33a | 58.37b | 68.88a | 0.6851 | 0.0854 | <0.0001 | 0.0065 |
12 | 73.60bc | 76.87ab | 67.51c | 79.37a | 71.67d | 79.16a | 0.7966 | 0.0542 | <0.0001 | 0.0006 | |
24 | 91.83ab | 95.83a | 82.12c | 96.04a | 87.91b | 94.53a | 1.1434 | 0.0047 | <0.0001 | 0.0027 |
1) TMR treatments: CON, total mixed ration with oat hay, timothy, and alfalfa hay as roughage source (imported forage); CF, total mixed ration with oat hay, timothy, alfalfa hay, corn silage, and Italian ryegrass silage as roughage source (combined forage of imported and domestic source); IRS-CS, total mixed ration with Italian ryegrass silage and corn silage as roughage source (domestic forage). TMR group: NF, non-fermented TMR; F, fermented TMR.
Parameters | TMR treatments1) | SEM | p-values2) | |||||||
---|---|---|---|---|---|---|---|---|---|---|
|
||||||||||
CON | CF | IRS-CS | ||||||||
|
|
|
|
|||||||
NF | F | NF | F | NF | F | Forage | Type | F×T | ||
General bacteria | 7.64 | 7.65 | 7.59 | 7.61 | 7.61 | 7.49 | 0.0429 | 0.1130 | 0.3449 | 0.2397 |
Protozoa | 5.36 | 5.35 | 5.39 | 5.36 | 5.37 | 5.37 | 0.0538 | 0.8589 | 0.9211 | 0.9190 |
General anaerobic fungi | 5.34 | 4.98 | 4.75 | 4.69 | 4.87 | 4.50 | 0.1399 | 0.0870 | 0.0412 | 0.4932 |
Lactobacillus spp. | 7.51 | 7.71 | 7.42 | 7.45 | 7.46 | 7.47 | 0.0912 | 0.1673 | 0.3105 | 0.5141 |
Bacillus spp. | 7.29 | 7.32 | 7.22 | 7.27 | 7.26 | 7.13 | 0.0449 | 0.0731 | 0.6577 | 0.1331 |
Fibrobacter succinogenes | 5.41 | 6.10 | 5.68 | 5.58 | 5.51 | 5.51 | 0.4413 | 0.8571 | 0.5932 | 0.6272 |
Ruminococcus flavefaciens | 4.71 | 4.35 | 5.07 | 4.81 | 4.83 | 4.74 | 0.1962 | 0.1480 | 0.1617 | 0.7894 |
1) TMR treatments: CON, total mixed ration with oat hay, timothy, and alfalfa hay as roughage source (imported forage); CF, total mixed ration with oat hay, timothy, alfalfa hay, corn silage, and Italian ryegrass silage as roughage source (combined forage of imported and domestic source); IRS-CS, total mixed ration with Italian ryegrass silage and corn silage as roughage source (domestic forage). TMR group: NF, non-fermented TMR; F, fermented TMR.