N6-methyladenosine (m6A)-circHECA facilitates the differentiation of SHF stem cells into hair follicle lineage through miR-449a-5p/LEF1 mediated Wnt/β-catenin pathway in cashmere goats

Article information

Anim Biosci. 2026;39.250779
Publication date (electronic) : 2026 May 7
doi : https://doi.org/10.5713/ab.250779
1College of Animal Science & Veterinary Medicine, Shenyang Agricultural University, Shenyang, China
2Engineering Research Center for Animal Molecular Genetics and Breeding of Liaoning Province, Shenyang, China
*Corresponding Author: Wenlin Bai, Tel: +86-24-8848-7156, E-mail: baiwenlin@syau.edu.cn
Received 2025 October 17; Revised 2026 February 3; Accepted 2026 May 5.

Abstract

Objective

This study investigates the potential effect of N6-methyladenosine (m6A)-circHECA on the differentiation of SHF stem cells into hair follicle lineage along with the underlying molecular mechanisms in cashmere goats.

Methods

The effect of m6A-circHECA on the differentiation of SHF stem cells into hair follicle lineage was assessed through knockdown its expression in SHF stem cells derived from cashmere goats. The functional significance of m6A modification in circHECA functional exertion was confirmed through transfecting m6A deficient mutants into circHECA knockdown SHF stem cells. The competitive bindings of miR-449a-5p to m6A-circHECA and the 3′-untranslated region of LEF1 mRNA was investigated using Dual-luciferase reporter assay.

Results

The m6A-circHECA exhibited significantly higher expression in SHF stem cells post-differentiation than pre-differentiation. Moreover, m6A-circHECA facilitated the differentiation process of SHF stem cells into hair follicle lineages. The m6A-circHECA sequestering miR-449a-5p, to enhance the expression of the LEF1 gene in SHF stem cells and activating the Wnt/β-catenin signaling pathway. We further demonstrated that the m6A modification within circHECA is necessary for the miR-449a-5p/LEF1 mediated Wnt/β-catenin pathway, which promote the differentiation of SHF stem cells into hair follicle lineages via the introduction of a m6A-deffcient mutant of circHECA.

Conclusion

The m6A-circHECA facilitates the differentiation of SHF stem cells into hair follicle lineage through miR-449a-5p/LEF1 mediated Wnt/β-catenin pathway in cashmere goats.

INTRODUCTION

Cashmere goats have been widely raised in agricultural and pastoral areas in northern China with great economic significance for local farmers and herdsmen [1]. As one of main products from cashmere goats, the cashmere has unique fiber qualities, such as smooth texture, lustrous color, and excellent warmth retention [2,3]. It is considered a high-grade raw material in textile industry, and its fabrics have highly been praised and favored by consumers [4]. Cashmere is produced from dynamic mini-organs called secondary hair follicles (SHFs) in the skin tissue of cashmere goats [5]. As well known, the periodic activity of cashmere goat SHFs undergoes three main stages, consisting of anagen, catagen, and telogen. During SHF anagen, the differentiation event of SHF stem cells into hair follicle lineages under the signal stimulation from dermal papilla cells (DPCs) is crucial for the regeneration of SHFs along with the morphogenesis and growth of cashmere in cashmere goats [6]. Previously, the regulatory mechanisms on the differentiation of hair follicle stem cells were extensively investigated at functional genes [79], and signaling pathway levels [1012]. In fact, however, the differentiation of hair follicle stem cells into the hair follicle lineage is a complex physiological process where a variety of endogenous regulatory factors were implicated through a jointly coordinated regulatory network at multiple levels.

Over past few years, some non-coding RNAs were demonstrated to play significant roles in regulating the differentiation process of hair follicle stem cells into hair follicle lineages. It was reported that the miR-22 was revealed to negatively regulate the differentiation process of hair follicle stem cells through inhibiting the STK40 expression [13]. While the lncRNA PlncRNA 1 was found to facilitate the differentiation of hair follicle stem cells into hair follicle lineages through TGF-β1-mediated Wnt/β-catenin signaling pathway [10]. Also, several circRNAs were recorded to promote the differentiation process of SHF stem cells through miRNA mediated axes in cashmere goats, such as circRNA-1926 via miR-148a/b-3p/CDK19 axis [14], circRNA-0100 via miR-153-3p/KLF5 axis [6], and circRNA-1967 via miR-93-3p/LEF1 axis [15].

As well known, the N6-methyladenosine (m6A) is the most common post-transcriptional modification in eukaryotic linear RNAs including mRNAs, miRNAs, and lncRNAs [16,17]. Moreover, the m6A modification was essentially implicated in the functional exertion of the RNA molecules [18]. Interestingly, extensive m6A modification sites also were identified in many circRNAs molecules with functional significance [19,20]. It was demonstrated that m6A modification regulated the effect of circRNA-08436 on lipid metabolism of mammary glands in dairy goat [21]. The m6A modifications of circRNAs might also be largely implicated in the formation of pork quality [22], the infection of Marek’s disease virus in chicken [23], and the inflammation of mammary epithelial cells injured by Staphylococcus aureus and Escherichia coli in dairy cattle [24]. More recently, it was reported that the m6A modification of circCDK14 mediated by SRSF3 and hnRNP A1 plays a crucial role as an miR-4492-z sponge in regulating intramuscular fat deposition in yaks [25]. In cashmere goats, a considerable number of m6A modified circRNAs were identified from skin tissue or SHFs [5,26,27]. Moreover, the circRNA-ZNF638 and circERCC6 were proved to facilitate the activation process of SHF stem cells in cashmere goats through miRNA mediated pathways in m6A-dependent pattern [28,29].

The m6A modified circHECA (m6A-circHECA) was recently identified from cashmere goat SHFs with significantly higher expression at anagen SHFs compared with its counterpart of telogen, and its expression was detected mainly in cytoplasm of SHF stem cells of cashmere goats [30]. However, the potential functions of m6A-circHECA are unknown in SHF stem cells of cashmere goats. In this present study, we mainly investigated the effect of m6A-circHECA on the differentiation of SHF stem cells into hair follicle lineage in cashmere goats. Further, we explored the potential mechanisms of m6A-circHECA regulating the differentiation process of SHF stem cells. The results from this study would provide novel scientific evidence for unveiling the potential regulatory mechanisms on the differentiation of SHF stem cells into hair follicle lineage in cashmere goats.

MATERIALS AND METHODS

Cell co-culture and isolation of total RNA

Here, we utilized the SHF stem cells and DPCs of cashmere goats that have been stored in our laboratory [29]. The SHF stem cells were co-cultured (non-contact) with DPCs for inducing the differentiation to hair follicle lineages in a transwell devices as described in a previous publication [31]. In brief, the SHF stem cells were firstly seeded on six-well plates at a density of 1×104 cells/mL, and then, a transwell insert was added in which we seeded the DPCs 1×104 cells/mL. The two types cells (SHF stem cells and DPCs) were co-culture (non-contact) for 7 days in fresh DMEM/F12 medium (Hyclone). The incubator temperature was set as 37°C with the CO2 concentration of 5%. The medium was changed every 2 days. The total RNA from the harvested SHF stem cells was isolated using the RNAiso reagent kit following the manufacturer’s instructions (TaKaRa). In addition, for the expression analysis of circHECA and miR-449a-5p in SHFs of cashmere goats during different stages of SHF cycles, the total RNA was used that was extracted from SHFs of cashmere goats in our previous study [30].

Analysis of knockdown and overexpression of circHECA in SHF stem cells

For the knockdown of circHECA in SHF stem cells, three siRNAs (si-circHECA-1#, si-circHECA-2#, and si-circHECA-3#) were designed based on the upstream and downstream sequence of back splicing site of circHECA. The three designed siRNAs to circHECA are si-circHECA-1#: 5′-GCACAAGG GGCTCTTGAAGGTG-3′, si-circHECA-2#: 5′-AA GGGGCTCTTGAAGGTGACAG-3′, and si-circHECA-3#: 5′-GTTGCACAAGGGGCTCTTGAAG-3′. These three siRNAs were transfected respectively into SHF stem cells using the Lipofectamine RNAiMAX kits (Invitrogen) according to the manufacturer’s instructions. For the overexpression of circHECA in SHF stem cells, the overexpression vectors of circHECA (or its mutants) were constructed using the pcDNA3.1 (+) circRNA mini-vector (Addgene). The circHECA mutants were generated by the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies). The recombinant pcDNA3.1 (+) circHECA (or its mutant) was transfected into SHF stem cells by the Lipofectamine 3000 (Invitrogen) following the manufacturer’s instructions (Invitrogen).

Dual-Luciferase reporter assays

In the present study, the dual-luciferase reporter experiments were performed according to the assays described by Yu et al. [32]. Briefly, to define the specific binding of circHECA with miR-449a-5p, we generated the luciferase reporters through ligating the circHECA (circHECA-WT) or its mutant (circHECA-MUT) into pGL3-basic vectors (Promega). The circHECA-MUT was generated by the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies), where the potential binding sites of miR-449a-5p seed region were replaced with the corresponding complementary base. Similarly, to confirm the specific binding of the LEF1 mRNA 3′-untranslated region (3′-UTR) with miR-449a-5p, the 3′-UTR fragment of cashmere goat LEF1 mRNA (containing the putative binding region of miR-449a-5p) was amplified and further ligated into the pGL3 basic vector (Promega). The constructed reporter vectors were transfected into the 293T cells using the Lipofectamine 2000 (Invitrogen), respectively. The transfected 293T cells were cultured for 48 h. And then, the cells were collected, and lysed using lysate (Beyotime), followed by measurement of luciferase activity with the Dual-Luciferase Reporter Assay System (Promega). The relative ratio of firefly luciferase to Renilla luciferase activities was calculated to eliminate the potential bias from transfection efficiency among different samples.

Overexpression and knockdown of miR-449a-5p and LEF mRNA

For the overexpression and knockdown of miR-449a-5p, its mimics and inhibitors were commercially obtained from Shanghai GenePharma with the corresponding negative controls (NC). For the overexpression of LEF1 gene in SHF stem cells of cashmere goats, its overexpression vectors were generated where the cDNA was synthesized from the total RNA isolated from cashmere goat SHFs using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa). For amplifying the coding sequence of LEF1 mRNA, we designed a pair of primers according to the goat LEF1 mRNA sequence (GenBank accession: XM_018049144.1). The polymerase chain reaction (PCR) amplifications were performed to obtain the coding sequence of goat LEF1 mRNA by the Phanta Max Super-Fidelity DNA Polymerase (Vazyme). The amplified products were purified and cloned to the pcDNA3.1(+) vector. For the knockdown of LEF mRNA in SHF stem cells of cashmere goats, the small interference RNA targeting LEF1 mRNA (siRNA-LEF1) were commercially obtained from Shanghai GenePharma with its negative control (siRNA-NC). The small RNA molecules were transfected into SHF stem cells using the Lipofectamine RNAiMAX kits according to the manufacturer’s instructions including mimics and inhibitors of miR-449a-5p, siRNA-LEF1 and siRNA-NC (Invitrogen). The generated overexpression vector of LEF1 mRNA was transfected into SHF stem cells of cashmere goats by the Lipofectamine 3000 following the manufacturer’s instructions (Invitrogen).

Quantitative real-time polymerase chain reaction reactions

In qPCR analysis, all primers used are provided in Table 1. The qPCR reactions were carried out in a final volume of 25 μL consisting of Green Premix Ex Taq II of 12.5 μL TB (TliRNaseH Plus; TaKaRa), each primer of 1.0 μL (10 μM), the first-strand cDNA solution of 2.0 μL, and ddH2O water of 8.5 μL. The thermal cycling parameters were comprised of a single cycle of 95°C for 3 min, followed by 40 cycles of 9°C for 5 s, 53°C–60°C (Table 1) for 30 s, and 72°C for 30 s. The GAPDH was used as internal controls for expression analysis of circHECA and tested mRNAs, whereas the U6 was used as internal controls for expression analysis of miR-449a-5p. Ultimately, the relative expression of analyzed RNA molecules was calculated with the 2−ΔΔCt method [33].

Detail of PCR primers utilized in this study along with the corresponding annealing temperature for PCR amplification

Data statistical analysis

The obtained data was presented as mean±standard error, and analyzed using the SPSS 17.0 procedure (SPSS). The graphical representations were performed using the GraphPad Prism 8 software (GraphPad Software). The mean difference between analyzed groups was compared by the unpaired Student’s t-test. The obtained p-values<0.05 were considered significant statistically.

RESULTS AND DISCUSSION

Expression characterization of m6A-circHECA in SHF stem cells before and after differentiation, and its effects on the differentiation into hair follicle lineages

To explore the potential role of m6A-circHECA in the differentiation of SHF stem cells into hair follicle lineages, firstly, we investigated its expression changes in SHF stem cells before and after differentiation. As shown in Figure 1A, m6A-circHECA exhibited significantly higher expression in SHF stem cells after differentiation than that before differentiation. Thus, it is reasonable to assume that m6A-circHECA may play certain role in the differentiation process of SHF stem cells into hair follicle lineages in cashmere goats. To define the hypothesis, we carried out a knockdown analysis of m6A-circHECA in SHF-stem cells through siRNA interference experiments. We designed three independent siRNAs and named as si-circHECA-1#, si-circHECA-2# and si-circHECA-3#. Based on their knockdown efficiency to m6A-circHECA in SHF-stem cells of cashmere goats (Figure 1B), the si-circHECA-1# was chosen and utilized in further knockdown experiment of m6A-circHECA. As shown from Figure 1C, the si-circHECA-1# -mediated knockdown of m6A-circHECA led to a significant decrease in the expression of several indicator genes on upon SHF-stem cell differentiation (including Keratin 6, Keratin 7, Keratin 8, Keratin 16 and Keratin 17) in comparison to their counterparts of the blank cells and negative control group (si-control) (Figure 1C). These results suggest that m6A-circHECA may facilitate the differentiation process of SHF stem cells into hair follicle lineages via certain mechanisms. Here, the Keratins 6,7,8,16,17 were chosen as biomarkers of SHF differentiation into hair follicle lineages based on the previous publications where the biomarker role of Keratin 6,7,8,16,17 in SHF differentiation into hair follicle lineages was described in detail [6,14,15].

Figure 1

The relative expression of m6A-circHECA in SHF stem cells before and after differentiation with its functional significance in the differentiation of SHF stem cells into hair follicle lineages in cashmere goats. (A) The relative expression of circHECA in SHF stem cells before and after differentiation into hair follicle lineages. (B) Knockdown efficiency analysis of si-circHECA-1#, si-circHECA-2# and si-circHECA-3# to circHECA in SHF stem cells of cashmere goats. (C) Knockdown of circHECA led to the significant decrease in expression level of the analyzed indicator genes in SHF stem cells. (D) Effect of circHECA on the expression of its host HECA gene. ‘*’ represents the significant difference compared with the si-control, p<0.05. ‘ns’ represents no significant difference, p>0.05. The ‘blank cells’ refers to the group of cells that did not receive any treatment, and it serves as a baseline to indicate the expression level of related molecules in native, unmodified cells. The ‘si-control’ was introduced as a control for ‘si-circHECA-1#’.

However, the knockout of m6A-circHECA had no significantly affect on the expression of its host gene HECA in SHF stem cells (Figure 1D), indicating that the host gene HECA of m6A-circHECA appears not to be involved in the observed effect of m6A-circHECA on the differentiation process of SHF stem cells into hair follicle lineages. To date, it is still unclear how m6A-circRNAs regulate the cell-fate decision of SHF-stem cells of cashmere goats at epigenetic level. Interestingly, there is growing evidence that m6A modification is closely related to the functional exertion of m6A-circRNAs [34,35]. As described in our recent study, four m6A modified sites were verified within the circHECA sequence, including m6A-213, m6A-297, m6A-780 and m6A-927 [30]. This drives us to ask whether the observed effect of m6A-circHECA on facilitating the differentiation process of SHF stem cells into hair follicle lineages was achieved through relying on its m6A modifications.

The m6A modification of circHECA is necessary in it facilitating the differentiation of SHF stem cells into hair follicle lineages

To confirm the above hypothesis, through pointing at the four verified m6A sites (m6A-213, m6A-297, m6A-780 and m6A-927) of (Figure 2A) of m6A-circHECA, we constructed the wild type vectors of m6A-circHECA (circHECA: WT) and its mutation vectors (circHECA: A-G MUT) where the A-213, A-297, A-780 and A-927 in the m6A motif: RRACH were replaced with G-213, G-297, G-780 and G-927 respectively (Figure 2B). Also, a negative control mutant vectors (circHECA: NC MUT) was constructed in which the A-212, G-296, G-779 and A-926 within the m6A motifs: RRACH were replaced with G-212, A-296, A-779 and G-926, respectively (Figure 2B).

Figure 2

m6A-circHECA contributes the differentiation of SHF stem cells into hair follicle lineages in cashmere goats through relying on m6A modifications. (A) Overall diagram of m6A sites within circHECA of cashmere goat SHFs including m6A-213, m6A-297, m6A-780, and m6A-927. (B) The generation strategies for circHECA mutants against its m6A sites. circHECA:WT = wild type of circHECA, circHECA:A-G MUT = circHEAC mutant against the m6A sites, and circHECA:NC MUT = circHECA negative control mutant against the m6A sites. (C) The effects of m6A sites mutation on circHECA expression in SHF stem cells with circHECA knockdown. (D) The effects of m6A site mutation of circHECA on the expression of indicator genes in SHF stem cells with circHECA knockdown. The ‘*’ represents significant difference compared with si-control, p<0.05. The ‘si-control’ was introduced as a control for ‘si-circHECA-1#’. The ‘circHECA: NC MUT’ was introduced as a control for ‘circHECA: A-G MUT’.

In order to assess the potential role of m6A modification in functional exertion of m6A-circHECA in SHF stem cells, we transfected the circHECA: WT, circHECA: A-G MUT, or circHECA: NC MUT into circHECA-knockdown SHF stem cells with equal amounts, and further utilized them in the induced differentiation assays in vitro. As a result, the introduction of circHECA mutations did not lead to a significant change in its expression level in SHF stem cells (Figure 2C). Also, we noted that the decreasing expression of circHECA in circHECA-knockdown SHF stem cells was restored through the introduction of circHECA: WT or its mutants (circHECA: A-G MUT, or circHECA: NC MUT) (Figure 2C). Further, we evaluated the expression of the indicator genes (upon the differentiation of SHF stem cells) in the differently transfected cell lines. We found that the ‘si-circHECA-1#+circHECA: WT’ cell lines, not the ‘si-circHECA-1#+circHECA: A-G MUT’ cell lines, were significantly higher in expression abundance of the detected indicator genes, in comparison to the ‘si-circHECA-1# cell lines (Figure 2D). Here, we can rule out that the observed expression changes of the analyzed indicator genes between the two types of cell lines (‘si-circHECA-1#+circHECA: WT’ and ‘si-circHECA-1#+circHECA: A-G MUT’) are from the expression abundance of circHECA in the tested cell lines, as there is no significant difference in expression abundance of circHECA between the two types of cell lines (‘si-circHECA-1#+circHECA: WT’ and ‘si-circHECA-1#+circHECA: A-G MUT’) (Figure 2C). In addition, it is worth noting that the circHECA: NC MUT (m6A-decorated mutant) restored the decreasing expression of the indicator genes in circHECA m6A-deficient cell lines (Figure 2D). Taking into account these above results, we can draw a conclusion that the m6A modification of circHECA is necessary in its facilitating the differentiation of SHF stem cells into hair follicle lineages. Such significant roles of internal m6A modification within non-coding RNAs in their function exertion were also reported in linc1281 of mouse embryonic stem cells [36], as well as, circRNA-ZFN638 [28] and circERCC6 [29] of goat SHF stem cells.

The m6A-circHECA serves as miR-449a-5p sponge and may regulate its expression in SHF stem cells of cashmere goats

It is widely believed that most circular RNAs located in the cytoplasm can sequester natural miRNAs to further regulate the expression of corresponding target genes [37]. In previous study, it was verified that m6A-circHECA was mainly expressed in cytoplasm of SHF stem cells in cashmere goats [30]. As shown in Figure 3A, moreover, m6A-circHECA had potential binding relationships with several miRNAs, including chi-miR-449a-5p, chi-miR-129-3p, chi-miR-187, chi-miR-449b-3p, chi-miR-20b, and chi-miR-27a-5p [30]. To define which miRNAs can directly bind to m6A-circHECA, a luciferase reporter was generated which contained the linear full-length sequence of m6A-circHECA in the downstream of the firefly luciferase gene. We co-transfected the generated reporter into 293T cells with the predicted target miRNA mimics, respectively. As a result, we found that only the miR-449a-5p co-transfected cell lines exhibited the significantly decreasing luciferase activities of m6A-circHECA reporters, but not for the other miRNAs (chi-miR-129-3p, chi-miR-187, chi-miR-449b-3p, chi-miR-20b, and chi-miR-27a-5p) co-transfected cell lines (Figure 3B). Moreover, in SHFs of cashmere goats, we found that a significantly negative correlation relationship existed in expression pattern between m6A-circHECA and miR-449a-5p during SHF cycles: telogen, anagen and catagen (Figure 3C).

Figure 3

The m6A-circHECA sequesters miR-449a-5p to enhance the LEF1 expression SHF stem cells. (A) Based on in silico analysis, the potential target miRNAs binding with m6A-circHECA including miR-20b, miR-27a-5p, miR-129-3p, miR-449a-5p, miR-187, and miR-449b-3p. (B) Relative luciferase activities of reporters including circHECA in 293T cells after 48 h co-transfection with the predicated different miRNA mimics, respectively. (C) Expression correlation analysis of m6A-circHECA and miR-449a-5p in SHFs of cashmere goats at anagen, telogen, and catagen. (D) The generating manners of circHECA mutant (circHECA-MUT) for the binding sites of miR-449a-5p within circHECA. (E) Relative luciferase activities of reporters containing circHECA mutant (circHECA MUT) in 293T cells after 48 h co-transfection with the control mimics or miR-449a-5p mimics. (F) Relative expression of miR-449a-5p in SHF stem cells with circHECA knockdown. (G) Relative expression of LEF1 mRNA in SHF stem cells with circHECA knockdown. (H) A diagram of goat LEF1 mRNA with the in silico analysis on binding sites of miR-449a-5p within the 3′-UTR of LEF1 mRNA. The nucleotide positions were indicated following the goat LEF1 mRNA sequence at NCBI (https://www.ncbi.nlm.nih.gov) with accession number: XM_018049144.1. (I) Relative luciferase activities of reporters containing LEF1 mRNA 3’-UTR in SHF stem cells with circHECA knockdown. (J) The generating manners for 3’-UTR mutant of LEF1 mRNA (LEF1 mRNA3’-UTR-MUT) for the miR-449a-5p binding sites. (K) Relative luciferase activities of reporters including LEF1 mRNA-3’UTR mutant (LEF1 mRNA 3’UTR-MUT) in 293T cells after 48 h co-transfection with the control mimics or miR-449a-5p minics. The ‘*’ represents significant difference compared with the si-control, p<0.05. The ‘ns’ represents no significant difference, p>0.05.

To further validate this binding of m6A-circHECA and miR449a-5p, we constructed m6A-circHECA mutation luciferase reporters (circHECA MUT) that harbored an anti-sense mismatch of 7-nt long at the seed binding region of miR-449a-5p (Figure 3D). After co-transfection into 293T cells with miR-449a-5p, we found that the introduction of circHECA MUT reporters restored the miR-449a-5p-driven suppression in luciferase activities of m6A-circHECA reporters (Figure 3E). Taken together, these results provided evidence that m6A-circHECA might serve as miR-449a-5p sponge in the SHF stem cells of cashmere goats. On the other hand, we found that the knockdown cell lines of m6A-circHECA exhibited a significant increasing expression of miR-449a-5p in SHF-stem cells in comparison to the negative control cell lines (si-control) (Figure 3F). On the contrary, the knockdown of miR-449a-5p had no significant effect on the expression of m6A-circHECA in SHF stem cells of cashmere goats (data not shown). Thus, it can be suggested that m6A-circHECA may negatively regulate the miR-449a-5p expression in SHF-stem cells. Such regulatory mode was also reported in osteosarcoma cells where circ_0081001 bound with miR-494-3p and negatively regulated its expression [38]. Also, an investigation on glioma, Ke et al. [39] found that circ_0076931 can bind with miR-6760-3p, and negatively regulated its expression glioma cells.

The m6A-circHECA upregulates the expression LEF1 gene in SHF stem cells via miR-449a-5p mediated mechanism

As is well known, the canonical Wnt signaling pathway plays a crucial role in the morphogenesis, development and growth of hair follicles [40]. Whereas, LEF1 is a key transcription factor that is deeply implicated in the activity of canonical Wnt signaling pathway. In previous investigations, it has been shown that LEF1 can facilitate the differentiation of SHF stem cells into hair follicle lineages under the activated status of Wnt signaling pathway [15,41]. This drove us to ask whether the LEF1 might be involved in the revealed effect of m6A-circHECA on the differentiation of SHF stem cells into hair follicle lineages (Figure 1C). Thus, we further analyzed the LEF1 expression in m6A-circHECA knockdown SHF stem cells. As a result, we found that the si-circHECA-1# mediated knockdown of m6A-circHECA led to a significant decreasing of LEF1 expression in the analyzed cells (Figure 3G). Interestingly, we have verified that m6A-circHECA can sponge miR-449a-5p (Figures 3B, 3D, 3E). Moreover, the LEF1 was also predicted as a potential target gene of miR-449a-5p in cashmere goats [30]. These findings raised a most likely mechanism that m6A-circHECA might positively regulate the LEF1 expression in SHF stem cells via miR-449a-5p-mediated pathway.

To ascertain this hypothesis, firstly, we screened the potential binding sites of miR-449a-5p within the 3’-UTR region of LEF1 mRNA based on in silico analysis. As a result, a potential binding site of miR-449a-5p was revealed in 3’-UTR region of goat LEF1 mRNA with a 6 mer binding type of seed region and −21.1 ΔG (Kcal/mol) (Figure 3H). Secondly, we generated a luciferase reporter of 3’-UTR region of LEF1 mRNA containing the potential binding site for miR-449a-5p, and co-transfected into the SHF stem cells with si-circHECA-1#, respectively. We noted that the knockdown of m6A-circHECA (si-circHECA-1#) significantly decreased the relative luciferase activity of LEF1 mRNA 3’-UTR in SHF stem cells in comparison to siRNA control (si-control) (Figure 3I). Further, we generated a mutant luciferase report (LEF1 mRNA 3’-UTR-MUT) that contained an antisense mismatch region of 7-nt long against seed region of miR-449a-5p (Figure 3J), co-transfected into SHF-stem cells with miR-449a-5p mimics. As shown in Figure 3K, there is no significant difference in relative luciferase activity of mutation reporters between miR-449a-5p mimics and the control mimic cell lines. These results indicated that the miR-449a-5p directly bound with LEF1 mRNA 3’-UTR in SHF stem cells of cashmere goats.

Taking into account these above results, it appears to become apparent that m6A-circHECA upregulates the LEF1 expression through sequestering miR-449a-5p in SHF stem cells of cashmere goats. This is a canonical regulatory mode for the function exertion of many circRNA molecules [37]. In fact, however, circRNAs can play biological roles in cells via multiple regulatory mode, such as regulating the transcription of corresponding host gene [42], RNA alternative splicing and maturation, protein scaffolding and localization [43], and acting as templates for protein translation [44]. Therefore, we strongly recommended that the other regulatory pathways of m6A-circHECA should be further investigated in SHF stem cells, which may have further implications for understanding the biological functions of m6A-circHECA in SHF stem cells of cashmere goats.

The m6A modification is necessary for m6A-circHECA biological function through miR-449a-5p/LEF1 pathway

Increasing lines of evidence have demonstrated that m6A modifications in RNA molecules play critical roles in RNA splicing, maturity, transportation, stability and translation [45,46]. Although, the biological roles of m6A modification in circRNAs still needs to be elucidated, there is evidence that m6A modification in some non-coding RNAs were necessary in their interactions with target miRNAs, such as linc1281 with let-7 family [36], circRNA-ZNF638 and miR-361-5p [28], and circERCC6 and miR-412-3p [29]. Thus, we have reason to ask whether m6A modification of circHECA is necessary for its the observed effect on the differentiation of SHF stem cells through miR-449a-5p/LEF1 pathway.

To validate this hypothesis, firstly, we investigated expression changes of miR-449a-5p in ‘si-circHECA-1#+ circHECA:WT’, ‘si-circHECA-1#+circHECA: A-G MUT’, and ‘si-circHECA-1#+circHECA: NC MUT’ transfected SHF stem cell lines, respectively. We found that both ‘si-circHECA-1#+circHECA:WT’ and ‘si-circHECA-1#+circHECA: NC MUT’ led to significant decreasing in miR-449a-5p expression compared with ‘si-circHECA-1#’ cell lines (Figure 4A). On the contrary, the ‘si-circHECA-1#+circHECA: A-G MUT’ cell lines still showed high levels of miR-449a-5p expression (Figure 4A), while it should be noted that circHECA transcript abundances had no significant difference among the different treated cell lines (Figure 2C). Secondly, we investigated the expression changes of LEF mRNA in the different treated cell lines. As shown in Figure 4B, both ‘si-circHECA-1#+circHECA:WT’ and ‘si-circHECA-1#+circHECA: NC MUT’ led to significant increasing in LEF1 mRNA expression compared with ‘si-circHECA-1#’ cell lines (Figure 4B), whereas the ‘si-circHECA-1#+circHECA: A-G MUT’ cell lines still showed low levels of LEF1 mRNA expression (Figure 4B). Based on above these results, it can be suggested that the m6A modification of circHECA is necessary for its the observed effect on the differentiation of SHF stem cells through miR-449a-5p/LEF1 pathway.

Figure 4

The m6A modification within circHECA is necessary for its functional role through miR-449a-5p/LEF1 axis that restored the differentiation of SHF stem cells into hair follicle lineages with circHECA-deficiency. (A, B) The effects of m6A sites mutations of circHECA on the expression of miR-449a-5p and LEF mRNA in SHF stem cells with circHECA knockdown, respectively. (C, D) The effects of miR-449a-5p inhibitor on the expression of miR-449a-5p and LEF1 mRNA in SHF stem cells with circHECA knockdown. (E, F) Both miR-449a-5p inhibitor and LEF overexpression led to significant increased expression of the indicator genes in SHF stem cells with circHECA knockdown. ‘*’ represents significant difference compared with the si-control, p<0.05, whereas ‘#’ represents significant difference compared with the si-circHECA-1#, p<0.05. The ‘si-control’ was introduced as a control for ‘si-circHECA-1#’. The ‘circHECA: NC MUT’ was introduced as a control for ‘circHECA: A-G MUT’.

Currently, it is generally believed that the specific binding of miRNAs to circRNA/lncRNAs is driven by the base pairing based on nucleic acid sequences, however, it has remained elusive that whether there is any mediator to regulate this binding process [29,36]. Interestingly, the presence of m6A peak at the binding region of mRNAs with miRNAs suggests a most likely mechanism that m6A modification within mRNAs may collaborate with the corresponding miRNAs to ultimately regulate the mRNA expression in biological cells [47]. In the present work, we showed that the the m6A modification of circHECA was responsible for its binding with miR-449a-5p, which has been verified by the m6A-deficient A-G mutant of circHECA that hindered the binding of circHECA with miR-449a-5p (Figures 4A, 4B). Thus, although it still needs further clarification whether m6A modification of circHECA alters its local structure as previously described by Liu and colleagues [48] thereby facilitating the binding of circHECA with miR-449a-5p, our results provided valuable insights into the regulatory model of circRNA relying on m6A modification to promote the differentiation of SHF stem cells into hair follicle lineages in cashmere goats.

The miR-449a-5p/LEF1 axis restores the differentiation of SHF stem cells into hair follicle lineages with m6A-circHECA deficiency

Given the above results, we further investigative whether the miR-449a-5p/LEF1 axis is responsible for the positive effect of m6A-circHECA on the differentiation of SHF stem cells into hair follicle lineages through inhibiting miR-449a-5p abundance in SHF stem cells with m6A-circHECA knockdown. As shown in Figure 4C, the introduction of miR-449a-5p inhibitor resulted in a significant decrease in miR-449a-5p abundance in the m6A-circHECA knockdown cells, whereas the LEF1 mRNA abundance was significantly upregulated by the miR-449a-5p inhibitor in transfected cells (Figure 4D). On the other hand, we noted that the inhibition of miR-449a-5p could restore the restricted differentiation of SHF stem cells into hair follicle lineages after m6A-circHECA knockdown, which could be determined via the significant increase in expression level of the indicator genes (Figure 4E).

In addition, given LEF1 mRNA was subjected to the negative regulation by miR-449a-5p (Figures 3H, 3K), moreover, the its expression was significantly down-regulated in SHF stem cells with m6A-circHECA knockdown (Figure 4B). Therefore, we want to know if LEF1 promotes the potential mechanism of m6A-circHECA/miR-449a-5p regulatory model. For this purpose, we overexpressed the LEF1 in SHF stem cells with m6A-circHECA knockdown. As a result, the overexpression of LEF1 restored the restricted differentiation of SHF stem cells into hair follicle lineages resulting from m6A-circHECA deficiency, which can be determined by the significant upregulation in expression abundance of the indicator genes in transfected SHF-stem cells (Figure 4F).

In previous studies, it was demonstrated that LEF1 expression was significantly upregulated at anagen phase during the hair follicle cycle [49], and LEF1 could guide the special organization of hair follicles with the regulation on the fate of epithelial cells [50]. Also, the LEF binding with TCF protein regulates many genes implicated in hair follicle development [51], and LEF1 promotes the SHF maturation [52]. The overexpression of LEF1 facilitates the proliferation of hair follicle stem cells and inhibits their apoptosis, whereas knockout of LEF1 reverses these effects [53]. These studies demonstrated the impact of LEF1 on the growth and development of hair follicles. Here, we showed that the LEF1 is eventually responsible for the m6A-circHECA role in contributing the differentiation of SHF stem cells into hair follicle lineages via the miR-449a-5p mediated model, in which the m6A modification of circHECA is necessary. Our this result further supported the previous findings that LEF1 contributed the differentiation of bulge stem cells toward a hair fate [54].

CircHECA relying on m6A modification to activate the Wnt/β-catenin pathway through miR-449a-5p/LEF1 axis

As is well known, the LEF1 is a vital transcriptional factor of the Wnt/β-catenin signaling pathway that guides the fate of hair follicle stem cells in which the LEF1 plays a key role via facilitating the nuclear translocation of β-catenin [50,54]. Given the association of LEF1 with m6A-circHECA function in differentiation of SHF stem cells in cashmere goats, we further investigated the effect of circHECA relying on m6A modification on the Wnt/β-catenin pathway through miR-449a-5p/LEF1 axis, which was evaluated by testing several keys signaling molecules of Wnt/β-catenin pathway including LEF1, Survivin, c-Myc, β-catenin, and Cyclin D1. As shown in Figure 5A, the ‘si-circHECA-1#+circHECA: WT’ cell lines, not the ‘si-circHECA-1#+circHECA: A-G MUT’ cell lines, were significantly higher in mRNA expression of the tested genes, in comparison to the ‘si-circHECA-1#’ cell lines, while the circHECA: NC MUT (m6A-decorated mutant) restored the decreasing expression of the tested genes in circHECA m6A-deficient cell lines (Figure 5A). These results showed that circHECA activated the Wnt/β-catenin pathway where the m6A modification within circHECA molecule was required.

Figure 5

CircHECA relying on m6A modification to activate the Wnt/β-catenin pathway through miR-449a-5p/LEF1 axis. (A) The effects of m6A site mutation within circHECA on the expression of Wnt/β-catenin pathway related genes in SHF stem cells with circHECA knockdown. (B) The m6A-circHECA activates Wnt/β-catenin pathway through miR-449a-5p/LEF1 axis. The ‘*’ represents significant difference between the compared groups, p<0.05. The ‘si-control’ was introduced as a control for ‘si-circHECA-1#. The ‘anti-control’ was introduced as a control for ‘anti-miR-449a-5p’. The ‘circHECA: NC MUT’ was introduced as a control for ‘circHECA: A-G MUT’. The ‘pcDNA’ was introduced as a control for ‘pcDNA-LEF1’.

Further, we explore whether the effect of m6A-circHECA on activating Wnt/β-catenin pathway may be achieved through miR-449a-5p/LEF1 axis. We transfected the miR-449a-5p inhibitor or pcDNA-LEF1 in SHF stem cells with m6A-circHECA knockdown. As shown in Figure 5B, the knockdown of m6A-circHECA significantly downregulated the mRNA expressions of Wnt/β-catenin pathway related genes (LEF1, Survivin, c-Myc, β-catenin, and Cyclin D1) in comparison to the corresponding control cell lines (si-circHECA-1#+anti-control). Interestingly, these effects were counterbalanced through the introduction of miR-449a-5p inhibitor or pcDNA-LEF1 (Figure 5B). Taken together above these results, it can be inferred that circHECA relying on m6A modification to activate the Wnt/β-catenin pathway through sponging miR-449a-5p mediated LEF1 upregulation.

Over the past few years, increasing regulatory factors have been discovered for the differentiation of SHF stem cells into hair follicle lineages in cashmere goats [6,14,15]. Herein, m6A-circHECA was identified to facilitate the differentiation of SHF stem cells into hair follicle lineage through miR-449a-5p/LEF1 mediated Wnt/β-catenin pathway. Although it is not yet known whether there is other model by which m6A-circHECA is implicated in Wnt/β-catenin pathway, our results implied that m6A-circHECA positively regulated the Wnt/β-catenin pathway by sponging miR-449a-5p mediated LEF1 upregulation in SHF stem cells of cashmere goats. Thus, we elucidated a novel molecular pathway: m6A-circHECA/miR-449a-5p/LEF1/Wnt/β-catenin in the differentiation of SHF stem cells toward hair follicle lineages (Figure 6), and provided evidences for m6A-circHECA to act as a potential regulating target to the differentiation of SHF stem cells in cashmere goats. In this work, however, we must point out that, firstly, the current study was conducted in SHF stem cells of cashmere goats cultured in vitro; and secondly, we tested the expression abundance of the analyzed genes at mRNA level, but not at protein level. Thus, the revealed significant role of m6A-circHECA along with the molecular mechanism above should be further validated in SHF stem cells of cashmere goats in vivo with the expression testing of the involved genes at protein level as suggested in previous publication [55].

Figure 6

A schematic representation of circHECA relying on m6A modification to facilitate the differentiation of SHF stem cells into hair follicle lineages through miR-449a-5p/LEF1 mediated Wnt/β-catenin pathway in cashmere goats.

CONCLUSION

The circHECA relying on m6A modification to contribute the differentiation of SHF stem cells into hair follicle lineage in cashmere goats, and this revealed functional role of circHECA may be achieved through miR-449a-5p/LEF1 mediated Wnt/β-catenin pathway.

Notes

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

AUTHORS’ CONTRIBUTION

Conceptualization: Fan Y, Bai W.

Data curation: Fan Y, Hui T, Zhang Q.

Formal analysis: Fan Y, Hui T, Zhang Q, Xu R, Shen J.

Methodology: Fan Y, Bai M, Bai W.

Software: Hui T, Bai M.

Validation: Fan Y, Hui T, Zhang Q, Xu R, Shen J.

Investigation: Fan Y, Hui T, Zhang Q, Xu R, Shen J, Zhu Y.

Writing - original draft: Fan Y.

Writing - review & editing: Fan Y, Hui T, Zhang Q, Xu R, Shen J, Zhu Y, Bai M, Bai W.

FUNDING

This study was funded by National Natural Science Foundation of China (grant numbers 32372859, 32172705, and 31872325).

ACKNOWLEDGMENTS

The authors thank Di Han for help in collecting skin samples from the Liaoning cashmere goats.

SUPPLEMENTARY MATERIAL

Not applicable.

ETHICS APPROVAL

All experimental procedures have been reviewed and approved by the Experimental Animal Ethics and Welfare Committee of Shenyang Agricultural University with the ethical code: 2023030208.

DECLARATION OF GENERATIVE AI

No AI tools were used in this article.

DATA AVAILABILITY

Upon reasonable request, the datasets of this study can be available from the corresponding author.

References

1. Di R, Vahidi SMF, Ma YH, et al. Microsatellite analysis revealed genetic diversity and population structure among Chinese cashmere goats. Anim Genet 2011;42:428–31. https://doi.org/10.1111/j.1365-2052.2010.02072.x.
2. Zhou B, Xi H, Yu Y, et al. Comparative analysis of skin transcriptome reveals differences of cashmere fineness in different body parts of Inner Mongolia cashmere goats. Anim Biosci 2025;38:2612–23. https://doi.org/10.5713/ab.25.0119.
3. Fan Y, Gong T, Feng S, et al. Transcriptome analysis reveals the key long non-coding RNAs and genes related to cashmere shedding in goats. Anim Biosci 2026;39:250499. https://doi.org/10.5713/ab.25.0499.
4. Han M, Rong Y, Ma B, et al. Progress on genome-wide association studies and selection signature analysis for agronomic traits in Chinese sheep and goats: review. Anim Biosci 2026;39:250465. https://doi.org/10.5713/ab.25.0465.
5. Bai M, Shen J, Fan Y, et al. N6-methyladenosine (m6A)-circular RNA pappalysin 1 (circPAPPA) from cashmere goats: identification, regulatory network and expression potentially regulated by methylation in secondary hair follicles within the first intron of its host gene. Animals 2025;15:581. https://doi.org/10.3390/ani15040581.
6. Zhao J, Shen J, Wang Z, et al. CircRNA-0100 positively regulates the differentiation of cashmere goat SHF-SCs into hair follicle lineage via sequestering miR-153-3p to heighten the KLF5 expression. Arch Anim Breed 2022;65:55–67. https://doi.org/10.5194/aab-65-55-2022.
7. Folgueras AR, Guo X, Pasolli HA, et al. Architectural niche organization by LHX2 is linked to hair follicle stem cell function. Cell Stem Cell 2013;13:314–27. https://doi.org/10.1016/j.stem.2013.06.018.
8. Shirokova V, Biggs LC, Jussila M, Ohyama T, Groves AK, Mikkola ML. Foxi3 deficiency compromises hair follicle stem cell specification and activation. Stem Cells 2016;34:1896–908. https://doi.org/10.1002/stem.2363.
9. Shen Q, Yu W, Fang Y, Yao M, Yang P. Beta-catenin can induce hair follicle stem cell differentiation into transit-amplifying cells through c-myc activation. Tissue Cell 2017;49:28–34. https://doi.org/10.1016/j.tice.2016.12.005.
10. Si Y, Bai J, Wu J, et al. LncRNA PlncRNA-1 regulates proliferation and differentiation of hair follicle stem cells through TGF-β1-mediated Wnt/β-catenin signal pathway. Mol Med Rep 2018;17:1191–7. https://doi.org/10.3892/mmr.2017.7944.
11. Zhang Y, Wu K, Wang L, et al. Comparative study on seasonal hair follicle cycling by analysis of the transcriptomes from cashmere and milk goats. Genomics 2020;112:332–45. https://doi.org/10.1016/j.ygeno.2019.02.013.
12. Hu XM, Li ZX, Zhang DY, et al. A systematic summary of survival and death signalling during the life of hair follicle stem cells. Stem Cell Res Ther 2021;12:453. https://doi.org/10.1186/s13287-021-02527-y.
13. Cai B, Li M, Zheng Y, et al. EZH2-mediated inhibition of microRNA-22 promotes differentiation of hair follicle stem cells by elevating STK40 expression. Aging 2020;12:12726–39. https://doi.org/10.18632/aging.103165.
14. Yin RH, Zhao SJ, Jiao Q, et al. CircRNA-1926 promotes the differentiation of goat SHF stem cells into hair follicle lineage by miR-148a/b-3p/CDK19 axis. Animals 2020;10:1552. https://doi.org/10.3390/ani10091552.
15. Zhu Y, Wang Y, Zhao J, et al. CircRNA-1967 participates in the differentiation of goat SHF-SCs into hair follicle lineage by sponging miR-93-3p to enhance LEF1 expression. Anim Biotechnol 2023;34:482–94. https://doi.org/10.1080/10495398.2021.1975729.
16. Paramasivam A, Priyadharsini JV, Raghunandhakumar S. Implications of m6A modification in autoimmune disorders. Cell Mol Immunol 2020;17:550–1. https://doi.org/10.1038/s41423-019-0307-0.
17. Zhang C, Liu N. N6-methyladenosine (m6A) modification in gynecological malignancies. J Cell Physiol 2022;237:3465–79. https://doi.org/10.1002/jcp.30828.
18. Porman AM, Roberts JT, Duncan ED, et al. A single N6-methyladenosine site regulates lncRNA HOTAIR function in breast cancer cells. PLoS Biol 2022;20:e3001885. https://doi.org/10.1371/journal.pbio.3001885.
19. Chen Z, Song J, Xie L, et al. N6-methyladenosine hypomethylation of circGPATCH2L regulates DNA damage and apoptosis through TRIM28 in intervertebral disc degeneration. Cell Death Differ 2023;30:1957–72. https://doi.org/10.1038/s41418-023-01190-5.
20. Li J, Xu X, Xu K, et al. N6-methyladenosine-modified circSLCO1B3 promotes intrahepatic cholangiocarcinoma progression via regulating HOXC8 and PD-L1. J Exp Clin Cancer Res 2024;43:119. https://doi.org/10.1186/s13046-024-03006-x.
21. Wang Y, Wu Y, Yang S, et al. m6A methylation mediates the function of the circRNA-08436/miR-195/ELOVL6 axis in regards to lipid metabolism in dairy goat mammary glands. Animals 2024;14:1715. https://doi.org/10.3390/ani14121715.
22. Qi K, Dou Y, Zhang Z, et al. Expression profile and regulatory properties of m6A-modified circRNAs in the longissimus dorsi of queshan black and large white pigs. Animals 2023;13:2190. https://doi.org/10.3390/ani13132190.
23. Sun A, Wang R, Yang S, et al. Comprehensive profiling analysis of the N6-methyladenosine-modified circular RNA transcriptome in cultured cells infected with Marek’s disease virus. Sci Rep 2021;11:11084. https://doi.org/10.1038/s41598-021-90548-1.
24. Xu H, Lin C, Li T, et al. N6-methyladenosine-modified circRNA in the bovine mammary epithelial cells injured by Staphylococcus aureus and Escherichia coli. Front Immunol 2022;13:873330. https://doi.org/10.3389/fimmu.2022.873330.
25. Qin C, Xu F, Yue B, Zhong J, Chai Z, Wang H. SRSF3 and hnRNP A1-mediated m6A-modified circCDK14 regulates intramuscular fat deposition by acting as miR-4492-z sponge. Cell Mol Biol Lett 2025;30:26. https://doi.org/10.1186/s11658-025-00699-6.
26. Hui T, Zhu Y, Shen J, et al. Identification and molecular analysis of m6A-circRNAs from cashmere goat reveal their integrated regulatory network and putative functions in secondary hair follicle during anagen stage. Animals 2022;12:694. https://doi.org/10.3390/ani12060694.
27. Zhang R, Liang J, Liu Z, et al. MeRIP-seq data analysis and validation reveal the regulatory role of m6A modified circRNAs in the apoptosis of secondary hair follicle cells in Inner Mongolia cashmere goats. Comp Biochem Physiol D Genomics Proteomics 2025;54:101419. https://doi.org/10.1016/j.cbd.2025.101419.
28. Yin R, Yin R, Bai M, et al. N6-methyladenosine modification (m6A) of circRNA-ZNF638 contributes to the induced activation of SHF stem cells through miR-361-5p/Wnt5a axis in cashmere goats. Anim Biosci 2023;36:555–69. https://doi.org/10.5713/ab.22.0211.
29. Zhang Q, Fan Y, Bai M, et al. CircERCC6 positively regulates the induced activation of SHF stem cells in cashmere goats via the miR-412-3p/BNC2 axis in an m6A-dependent manner. Animals 2024;14:187. https://doi.org/10.3390/ani14020187.
30. Shen J, Hui T, Bai M, et al. N6-methyladenosine (m6A)-circHECA from secondary hair follicle of cashmere goats: identification, regulatory network and expression regulated potentially by methylation of its host gene promoter. Anim Biosci 2024;37:2066–80. https://doi.org/10.5713/ab.24.0081.
31. Yan H, Gao Y, Ding Q, et al. Exosomal micro RNAs derived from dermal papilla cells mediate hair follicle stem cell proliferation and differentiation. Int J Biol Sci 2019;15:1368–82. https://doi.org/10.7150/ijbs.33233.
32. Yu C, Li L, Xie F, et al. LncRNA TUG1 sponges miR-204-5p to promote osteoblast differentiation through upregulating Runx2 in aortic valve calcification. Cardiovasc Res 2018;114:168–79. https://doi.org/10.1093/cvr/cvx180.
33. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001;25:402–8. https://doi.org/10.1006/meth.2001.1262.
34. Wu Z, Zuo X, Zhang W, et al. m6A-modified circTET2 interacting with HNRNPC regulates fatty acid oxidation to promote the proliferation of chronic lymphocytic leukemia. Adv Sci 2023;10:2304895. https://doi.org/10.1002/advs.202304895.
35. Liu F, Gu W, Shao Y. Cross-talk between circRNAs and m6A modifications in solid tumors. J Transl Med 2024;22:694. https://doi.org/10.1186/s12967-024-05500-4.
36. Yang D, Qiao J, Wang G, et al. N6-methyladenosine modification of lincRNA 1281 is critically required for mESC differentiation potential. Nucleic Acids Res 2018;46:3906–20. https://doi.org/10.1093/nar/gky130.
37. Hansen TB, Jensen TI, Clausen BH, et al. Natural RNA circles function as efficient microRNA sponges. Nature 2013;495:384–8. https://doi.org/10.1038/nature11993.
38. Liu S, Duan K, Zhang X, et al. Circ_0081001 down-regulates miR-494-3p to enhance BACH1 expression and promotes osteosarcoma progression. Aging 2021;13:17274–84. https://doi.org/10.18632/aging.203207.
39. Ke Y, Su S, Duan C, et al. Hsa_circ_0076931 suppresses malignant biological properties, down-regulates miR-6760-3p through direct binding, and up-regulates CCBE1 in glioma. Biosci Rep 2022;42:BSR20211895. https://doi.org/10.1042/BSR20211895.
40. Andl T, Reddy ST, Gaddapara T, Millar SE. WNT signals are required for the initiation of hair follicle development. Dev Cell 2002;2:643–53. https://doi.org/10.1016/S1534-5807(02)00167-3.
41. Ito M, Yang Z, Andl T, et al. Wnt-dependent de novo hair follicle regeneration in adult mouse skin after wounding. Nature 2007;447:316–20. https://doi.org/10.1038/nature05766.
42. Wang X, Li H, Lu Y, Cheng L. Regulatory effects of circular RNAs on host genes in human cancer. Front Oncol 2020;10:586163. https://doi.org/10.3389/fonc.2020.586163.
43. Geng Y, Jiang J, Wu C. Function and clinical significance of circRNAs in solid tumors. J Hematol Oncol 2018;11:98. https://doi.org/10.1186/s13045-018-0643-z.
44. Margvelani G, Maquera KAA, Welden JR, Rodgers DW, Stamm S. Translation of circular RNAs. Nucleic Acids Res 2025;53:gkae1167. https://doi.org/10.1093/nar/gkae1167.
45. Zhou Y, Jian N, Jiang C, Wang J. m6A modification in non-coding RNAs: mechanisms and potential therapeutic implications in fibrosis. Biomed Pharmacother 2024;179:117331. https://doi.org/10.1016/j.biopha.2024.117331.
46. Jin Y, Fan Z. New insights into the interaction between m6A modification and lncRNA in cancer drug resistance. Cell Prolif 2024;57:e13578. https://doi.org/10.1111/cpr.13578.
47. Meyer KD, Saletore Y, Zumbo P, Elemento O, Mason CE, Jaffrey SR. Comprehensive analysis of mRNA methylation reveals enrichment in 3’ UTRs and near stop codons. Cell 2012;149:1635–46. https://doi.org/10.1016/j.cell.2012.05.003.
48. Liu N, Dai Q, Zheng G, He C, Parisien M, Pan T. N6-methyladenosine-dependent RNA structural switches regulate RNA–protein interactions. Nature 2015;518:560–4. https://doi.org/10.1038/nature14234.
49. Hawkshaw NJ, Hardman JA, Alam M, Jimenez F, Paus R. Deciphering the molecular morphology of the human hair cycle: Wnt signalling during the telogen–anagen transformation. Br J Dermatol 2020;182:1184–93. https://doi.org/10.1111/bjd.18356.
50. Zhou P, Byrne C, Jacobs J, Fuchs E. Lymphoid enhancer factor 1 directs hair follicle patterning and epithelial cell fate. Genes Dev 1995;9:700–13. https://doi.org/10.1101/gad.9.6.700.
51. DasGupta R, Fuchs E. Multiple roles for activated LEF/TCF transcription complexes during hair follicle development and differentiation. Development 1999;126:4557–68. https://doi.org/10.1242/dev.126.20.4557.
52. Sun H, He Z, Xi Q, et al. Lef1 and Dlx3 may facilitate the maturation of secondary hair follicles in the skin of Gansu Alpine Merino. Genes 2022;13:1326. https://doi.org/10.3390/genes13081326.
53. Li J, Zhao B, Yao S, et al. Dermal PapillaCell-derived exosomes regulate hair follicle stem cell proliferation via LEF1. Int J Mol Sci 2023;24:3961. https://doi.org/10.3390/ijms24043961.
54. Zhang Y, Yu J, Shi C, et al. Lef1 contributes to the differentiation of bulge stem cells by nuclear translocation and cross-talk with the Notch signaling pathway. Int J Med Sci 2013;10:738–46. https://doi.org/10.7150/ijms.5693.
55. Xu R, Bai M, Fan Y, et al. Knockdown of miR-361-5p promotes the induced activation of SHF-stem cells through FOXM1 mediated Wnt/β-catenin pathway in cashmere goats. Anim Biotechnol 2024;35:2356110. https://doi.org/10.1080/10495398.2024.2356110.

Article information Continued

Figure 1

The relative expression of m6A-circHECA in SHF stem cells before and after differentiation with its functional significance in the differentiation of SHF stem cells into hair follicle lineages in cashmere goats. (A) The relative expression of circHECA in SHF stem cells before and after differentiation into hair follicle lineages. (B) Knockdown efficiency analysis of si-circHECA-1#, si-circHECA-2# and si-circHECA-3# to circHECA in SHF stem cells of cashmere goats. (C) Knockdown of circHECA led to the significant decrease in expression level of the analyzed indicator genes in SHF stem cells. (D) Effect of circHECA on the expression of its host HECA gene. ‘*’ represents the significant difference compared with the si-control, p<0.05. ‘ns’ represents no significant difference, p>0.05. The ‘blank cells’ refers to the group of cells that did not receive any treatment, and it serves as a baseline to indicate the expression level of related molecules in native, unmodified cells. The ‘si-control’ was introduced as a control for ‘si-circHECA-1#’.

Figure 2

m6A-circHECA contributes the differentiation of SHF stem cells into hair follicle lineages in cashmere goats through relying on m6A modifications. (A) Overall diagram of m6A sites within circHECA of cashmere goat SHFs including m6A-213, m6A-297, m6A-780, and m6A-927. (B) The generation strategies for circHECA mutants against its m6A sites. circHECA:WT = wild type of circHECA, circHECA:A-G MUT = circHEAC mutant against the m6A sites, and circHECA:NC MUT = circHECA negative control mutant against the m6A sites. (C) The effects of m6A sites mutation on circHECA expression in SHF stem cells with circHECA knockdown. (D) The effects of m6A site mutation of circHECA on the expression of indicator genes in SHF stem cells with circHECA knockdown. The ‘*’ represents significant difference compared with si-control, p<0.05. The ‘si-control’ was introduced as a control for ‘si-circHECA-1#’. The ‘circHECA: NC MUT’ was introduced as a control for ‘circHECA: A-G MUT’.

Figure 3

The m6A-circHECA sequesters miR-449a-5p to enhance the LEF1 expression SHF stem cells. (A) Based on in silico analysis, the potential target miRNAs binding with m6A-circHECA including miR-20b, miR-27a-5p, miR-129-3p, miR-449a-5p, miR-187, and miR-449b-3p. (B) Relative luciferase activities of reporters including circHECA in 293T cells after 48 h co-transfection with the predicated different miRNA mimics, respectively. (C) Expression correlation analysis of m6A-circHECA and miR-449a-5p in SHFs of cashmere goats at anagen, telogen, and catagen. (D) The generating manners of circHECA mutant (circHECA-MUT) for the binding sites of miR-449a-5p within circHECA. (E) Relative luciferase activities of reporters containing circHECA mutant (circHECA MUT) in 293T cells after 48 h co-transfection with the control mimics or miR-449a-5p mimics. (F) Relative expression of miR-449a-5p in SHF stem cells with circHECA knockdown. (G) Relative expression of LEF1 mRNA in SHF stem cells with circHECA knockdown. (H) A diagram of goat LEF1 mRNA with the in silico analysis on binding sites of miR-449a-5p within the 3′-UTR of LEF1 mRNA. The nucleotide positions were indicated following the goat LEF1 mRNA sequence at NCBI (https://www.ncbi.nlm.nih.gov) with accession number: XM_018049144.1. (I) Relative luciferase activities of reporters containing LEF1 mRNA 3’-UTR in SHF stem cells with circHECA knockdown. (J) The generating manners for 3’-UTR mutant of LEF1 mRNA (LEF1 mRNA3’-UTR-MUT) for the miR-449a-5p binding sites. (K) Relative luciferase activities of reporters including LEF1 mRNA-3’UTR mutant (LEF1 mRNA 3’UTR-MUT) in 293T cells after 48 h co-transfection with the control mimics or miR-449a-5p minics. The ‘*’ represents significant difference compared with the si-control, p<0.05. The ‘ns’ represents no significant difference, p>0.05.

Figure 4

The m6A modification within circHECA is necessary for its functional role through miR-449a-5p/LEF1 axis that restored the differentiation of SHF stem cells into hair follicle lineages with circHECA-deficiency. (A, B) The effects of m6A sites mutations of circHECA on the expression of miR-449a-5p and LEF mRNA in SHF stem cells with circHECA knockdown, respectively. (C, D) The effects of miR-449a-5p inhibitor on the expression of miR-449a-5p and LEF1 mRNA in SHF stem cells with circHECA knockdown. (E, F) Both miR-449a-5p inhibitor and LEF overexpression led to significant increased expression of the indicator genes in SHF stem cells with circHECA knockdown. ‘*’ represents significant difference compared with the si-control, p<0.05, whereas ‘#’ represents significant difference compared with the si-circHECA-1#, p<0.05. The ‘si-control’ was introduced as a control for ‘si-circHECA-1#’. The ‘circHECA: NC MUT’ was introduced as a control for ‘circHECA: A-G MUT’.

Figure 5

CircHECA relying on m6A modification to activate the Wnt/β-catenin pathway through miR-449a-5p/LEF1 axis. (A) The effects of m6A site mutation within circHECA on the expression of Wnt/β-catenin pathway related genes in SHF stem cells with circHECA knockdown. (B) The m6A-circHECA activates Wnt/β-catenin pathway through miR-449a-5p/LEF1 axis. The ‘*’ represents significant difference between the compared groups, p<0.05. The ‘si-control’ was introduced as a control for ‘si-circHECA-1#. The ‘anti-control’ was introduced as a control for ‘anti-miR-449a-5p’. The ‘circHECA: NC MUT’ was introduced as a control for ‘circHECA: A-G MUT’. The ‘pcDNA’ was introduced as a control for ‘pcDNA-LEF1’.

Figure 6

A schematic representation of circHECA relying on m6A modification to facilitate the differentiation of SHF stem cells into hair follicle lineages through miR-449a-5p/LEF1 mediated Wnt/β-catenin pathway in cashmere goats.

Table 1

Detail of PCR primers utilized in this study along with the corresponding annealing temperature for PCR amplification

Genes Reference Primer pair with sequence (5’–3’) Primer length (nt) Annealing temperature (°C) Amplicon size (bp)
circHECA (Divergent primers) Shen et al. [30] F: ACGATGTTCCCTGTCACCTT 20 57 87
R: TCGTCTTTCTCCAGGTCCAC 20
HECA XM_018053273.1 in GenBank F: CGGGGTTGTCGGTTCATAGAG 21 56 117
R: CGTGGAAAGTGTTCAGCTTGT 21
Keratin 6 Yin et al. [14] F: CAGTCGCAGCCTCTACAACCT 21 56 159
R: CAAATGCCACCTCCATAACCA 21
Keratin 7 Yin et al. [14] F: GAGTTTGTGGTGTTGAAGAA 20 56 194
R: AAGTCCAGGGAGCGGTTGTT 20
Keratin 8 Yin et al. [14] F: TCCTTCAGCAGCCGCTCCTA 20 58 160
R: CTGTAATGCCCCCCAAACCT 20
Keratin 16 Yin et al. [14] F: CCTTTGTGGCTAGTGGTATG 20 55 188
R: CAGTTTCAGGGGTTGCTTAT 20
Keratin 17 Yin et al. [14] F: GGGGAATGGAAACAGAGGAG 20 56 112
R: GAGGAGAGAAGCCCAAGATG 20
LEF1 Zhu et al. [15] F: CCACCTCTTGGCTGGTTTTC 20 56 176
R: TTTGGCTCCTGCTCCTTTCT 20
Survivin XM_005694094.3 in GenBank F: TTCAGCCCCAGCACAGACTA 20 55 216
R: GCCACACACACAAAAAGCCA 20
c-Myc XM_018058563.1in GenBank F: CTCACAGCCCGTTGGTCCTA 20 56 200
R: CCGCCTCTTGTCATTCTCCT 20
β-catenin XM_018066894.1in GenBank F: TGGAGCCAGACAGAAAAGCA 20 54 184
R: GTGAAGGACTGAGAAAACCC 20
Cyclin D1 XM_018043271.1 in GenBank F: GCCGAGGAGAACAAGCAGAT 20 58 94
R: TGGAGGGTGGGTTGGAAATG 20
GAPDH Yin et al. [28] F: TGAACCACGAGAAGTATAACAACA 24 53 125
R: GGTCATAAGTCCCTCCACGAT 21
miR-449a-5p MIMAT0036230 in miRNAsong F: CGTGGCAGTGTATTGTTAGCTGG 23 60 Not available
snRNA-U6 Yin et al. [28] F: CGCTTCGGCAGCACATATAC 20 55 Not available
R: AAATATGGAACGCTTCACGA 20

PCR, polymerase chain reaction.