ASAP1 gene InDel variants are associated with enhanced goat resistance against Brucella infection

Article information

Anim Biosci. 2026;39.250722
Publication date (electronic) : 2026 March 11
doi : https://doi.org/10.5713/ab.250722
1Shaanxi Provincial Engineering and Technology Research Center of Shaanbei Cashmere Goats, College of Advanced Agricultural Sciences, Yulin University, Yulin, China
2College of Veterinary Medicine/Shaanxi Centre of Stem Cells Engineering & Technology, Northwest Agriculture & Forestry University, Yangling, China
3Management Committee of Yulin Modern Agricultural Science and Technology Demonstration Zone, Yulin, China
4Shaanxi Shenao Agricultural Biotechnology Development Co., Ltd., Yulin, China
*Corresponding Author: Jinlian Hua, Tel: +86-13629285193, E-mail: jinlianhua@nwsuaf.edu.cn, Haijing Zhu, Tel: +86-18740685715, E-mail: haijingzhu@yulinu.edu.cn
aThese authors contributed equally to this work.
Received 2025 September 26; Revised 2025 October 29; Accepted 2026 March 9.

Abstract

Objective

This study aimed to investigate the potential of the ASAP1 gene as a genetic biomarker for brucellosis resistance/susceptibility in goats.

Methods

This study collected samples from female Shaanbei white cashmere (SBWC) goats to investigate the association between the ASAP1 gene and brucellosis susceptibility. Peripheral blood mononuclear cells (PBMCs) were isolated from goats with various haplo types and Brucella statuses, and the association was evaluated using polymerase chain re action (PCR), quantitative reverse transcription (qRT)-PCR, and lipopolysaccharide (LPS) stimulation assays.

Results

The ASAP1 gene was expressed most in the spleen, significantly more than in the kidney and heart (p<0.05). In the SBWC goats population, three genotypes insertion/insertion (II), insertion/deletion (ID), and deletion/deletion (DD) were identified at the P2, P5, and P7 sites of goat ASAP1 gene. Association analysis showed that P2 and P7 sites variants were associated with host resistance to Brucella infection with the II genotype used as reference (p<0.05; p<0.01) and maintained after multiple testing correction. The ASAP1 gene was observed lower expression in testicular tissues of Brucella-infected adult SBWC goats compared to healthy controls (p<0.01). Haplotype analysis revealed Hap3 and Hap5 were associated with brucellosis-resistant compared to Hap1 (p<0.05). PBMCs were isolated from goats carrying Hap1, Hap3, and Hap5. After LPS stimulation, significantly reduced ASAP1 expression was detected in the susceptible haplotype Hap1 compared to the resistant haplotypes. The highest expression level was exhibited by the most resistant haplotype, Hap5. Furthermore, resistant haplotypes showed more rapid activation of key inflammatory pathways and pro-inflammatory cytokines (NF-κB, IL-6, TNF-α, IFN-γ) compared to susceptible Hap1, with faster resolution of the inflammatory response observed, particularly in the most resistant haplotype Hap5.

Conclusion

The present study demonstrates that ASAP1 gene InDel variants influence brucellosis resistance in SBWC goats, providing a theoretical basis for breeding resistant populations.

INTRODUCTION

Brucellosis, which is by Brucella infection, is one of the most important and widespread bacterial zoonotic diseases worldwide. Brucella is a Gram-negative, short rod-shaped bacterium. Currently, six species and 19 biotypes have been identified. Among which Brucella melitensis [1] and Brucella abortus [2] pose the most significant threats to human health. In female animals, Brucella infected can cause abortion, loss of appetite, and difficulty walking, while male animals primarily develop orchitis and epididymitis [3].

According to an analysis of global and regional high-risk populations, approximately 500,000 human cases occur worldwide each year, with under-developed regions in Africa and Asia bearing the brunt of the burden [4]. Previous studies have shown that the host resistance to infectious disease is closely linked to genetic factors [5]. Therefore, identifying genetic markers associated with reduced risk of Brucella infection in goats and expanding disease-resistant populations represnt a fundamental strategy for mitigating the impacts of brucellosis. With rapid advances in genetics, molecular marker-assisted selection (MAS) is now widely used to improve growth and reproductive performance in goats, Among the available markers, SNP and InDels are the most commonly used [6], as they enable the accurate and rapidly identification of superior genotypes in livestock [7].

The ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 (ASAP1) gene produces a protein that contains SH3, ANK, and PH domains. This protein participates in cellular processes such as cytoskeletal regulation and vesicle transport [8,9]. ASAP1 has been show to regulate the phagocytic capacity of THP-1–derived macrophages against Mycobacterium tuberculosis H37Ra by remodeling the actin cytoskeleton [10]. The ASAP1 protein is predominantly expressed in specific immune cells, such as dendritic cells (DCs). Notably, infection with M.tuberculosis significantly downregulates ASAP1 expression in DCs [11]. However, the unique structure of Brucella lipopolysaccharide (LPS) distinguishes it from that of typical Gram-negative bacteria like Escherichia coli. Specifically, the lipid A moiety of Brucella LPS has a significantly longer fatty acid chain. This structural difference alters the molecule conformation and impairs its ability to bind effectively to the toll-like receptor 4/myeloid differentiation factor 2 (TLR4/MD-2) complex. Consequently, Brucella LPS induces NF-κB mediated immune cell activation to a mch lesser extent than E. coli LPS [12]. This failure to trigger a robust inflammatory response in DCs, a form of molecular mimicry may help Brucella evade detection by the host’s innate immune system.

To date, no studies have linked the ASAP1 gene to resistance against Brucella infection in goats. In this study, we first analyzed the expression profile of the ASAP1 gene in various tissues of Shaanbei white cashmere (SBWC) goats. We then detecte polymorphisms at InDel loci within the ASAP1 gene in goat populations and systematically invesrigated the correlation between these InDel variations and resistance to Brucella in SBWC goats.

MATERIALS AND METHODS

Experimental animals and sample collection

All experimental animals were obtained from a SBWC goats farm in Yulin City, Shaanxi Province, China. The goats were raised under identical feeding management and environmental conditions, including a standardized diet (comprising a total mixed ration of hay, corn silage, and concentrated feed), a controlled ambient temperature of 15°C–25°C, relative humidity of 50%–70%, a natural light cycle, and a set of biosecurity practices (including isolation of newly introduced animals, scheduled vaccination and deworming, regular disinfection of enclosures, and rodent control). These measures ensured a comparable brucellosis infection risk across all selected samples. A total of 1,145 unrelated adult female SBWC goats were randomly selected based on the following criteria: all goats were 3–5 years old, had a parity of 2–5, Although some goats were infected with Brucella, all exhibited a subclinical infection status, showing no abnormalities observed in mental status, appetite, or other clinical signs. 2 mL blood samples were collected via jugular venipuncture. The Rose Bengal Plate Agglutination Test (RBPT) was employed for serological testing of serum samples. Approximately 100 mg of ear tissue samples were collected and stored in 75% ethanol for DNA extraction. Various tissue samples, including major organs (heart, liver, spleen, lung, kidney), digestive tracts (rumen, small and large intestines), neural systems (cerebrum, cerebellum), and other tissues (skin, muscle, fat, ovary) were collected from healthy adult female SBWC goats. Testicular tissues were also obtained from 3-year-old male goats. Additionally, testicular tissue samples were collected from Brucella infected 3-year-old SBWC buck under the supervision of epidemic prevention authorities; these sample were aseptically sealed and stored. All tissue samples were kept at −80°C for subsequent RNA extraction.

Rose bengal plate test

After serum was separated from the collected blood, 20 μL was aliquoted onto the test plate. An equal volume of antigen was then added and thoroughly mixed with the test sample. The mixture was incubated at room temperature (approximately 20°C–25°C) for 4 min. The results was compared with standard positive and negative controls. Samples were recorded as positive if agglutination was observed, and negative if no agglutination was detected. All positive samples were re-examined to confirm the results. Subesequent analysis confirmed that among the 1,145 collected samples, 450 tested positive and 695 tested negative.

Primer design

The reference sequence of the goat ASAP1 gene (GenBank accession no. NC_030821.1) was acquired from the NCBI database (https://www.ncbi.nlm.nih.gov; accessed on 5 January 2024). Primers for the amplification of partial fragments of the ASAP1, GAPDH, NF-κB, and IL-6, TNF-α, IFN-γ, TGF-β genes were designed using the online NCBI Primer-BLAST tool (https://blast.ncbi.nlm.nih.gov; accessed on 17 December 2024). InDel variant information was screened and obtained from the Ensembl database (https://asia.ensembl.org/index.html) (Table 1).

Goat ASAP1 gene InDel detection and qRT-PCR primer pairs

RNA extraction and quantitative reverse transcription-polymerase chain reaction

Total RNA was isolated from collected tissue samples using TRIzol total RNA extraction reagent (Takara), in conjunction with isopropanol, anhydrous ethanol, chloroform, and other associated reagents. The first strand of cDNA was synthesized using the Prime Script RT kit (Takara). The resulting cDNA was diluted to a concentration for gene tissue expression analysis.

Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed using a 20 μL system, comprising 10 μL of 2×ChamQ SYBR qPCR Master Mix, 8 μL of RNase-free ddH2O, 1 μL each of upstream and downstream primers, and 1 μL cDNA template. The qRT-PCR amplification was conducted using a three-step program: pre-denaturation at 95°C for 3 minutes; followed by 40 cycles of denaturation at 95°C for 10 seconds and annealing/extension at 55°C for 30 seconds. The GAPDH geneserved as the internal reference, and the relative expression levels in each tissue were calculated using the 2−ΔΔCT method. All cDNA samples from different tissues were analyzed with three technical repeates [13].

DNA extraction and polymorphism detection

Genomic DNA was extracted from collected tissue samples using the high-salt method, The purity and concentration of each sample were measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). Finally, qualified DNA samples were diluted to a uniform concentration of 20 ng/μL and stored at −20°C.

The PCR reaction was carried out in a 13 μL system. The reaction procedure was composed of pre-denaturation at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 1 minutes, annealing at 50°C–65°C for 30 seconds, and extension at 72°C for 30 seconds; with a final extension step at 72°C for 7 minutes. The amplified products werethen held at 4°C. The PCR products were immediately analyzed by 3% agarose gel electrophoresis for genotyping. Sequencing was performed by a commercial provider (Sangon Biotech).

Lipopolysaccharide stimulation of goat peripheral blood mononuclear cells and cytokine detection

Goats whose genotype distribution matched Hap1, Hap3, and Hap5 of the goat ASAP1 gene were selected with three individuals from each haplotype serving as biological replicates. After the selected goats were confirmed negative by the RBPT, peripheral blood samples were collected. Goat peripheral blood mononuclear cells (PBMCs) were isolated using a commercial kit (TBD). After cells were cultured for 48 h in RPMI-1640 medium (Gibco) containing 10% fetal bovine serum and 1% dual antibiotics, the supernatant was removed, and any non-adherent or dead cells were rinsed away with PBS. The medium was replaced with fresh medium containing 500 ng/mL B. melitensis derived LPS, and the cultivation was continued for 24 h. Samples were harvested at 0, 1, 3, 6, 12, and 24 h for RNA extraction. The first strand of cDNA was synthesized to detect the expression levels of inflammatory factors, including NF-κB, IL-6, TGF-β, IFN-γ, TNF-α and ASAP1, with GAPDH serving as the internal reference gene. The relative expression levels of inflammatory factors were analyzed using the 2−ΔΔCT method, with each sample assayed in triplicate.

Statistical analysis

qRT-PCR results were analyzed using GraphPad prism ver. 10.5.0. Genetic diversity parameters for the ASAP1 gene variant loci, including population heterozygosity (He), homozygosity (Ho), and polymorphism information content (PIC), were estimated based on the Nei method [14]. The Hardy-Weinberg equilibrium (HWE) of these variant loci was assessed using the SHEsis (https://github.com/celaoforever/SHEsisPlus/blob/master/README.md ; accessed on 23 July 2024) platform and the Gdicall (http://www.msrcall.com/Gdicall.aspx; accessed on 23 July 2024) website. Differences in the distribution frequencies of genotypes and alleles were evaluated by the chi-squared test in SPSS 26.0 software. A logistic regression model was constructed to calculate odds ratios (OR) and 95% confidence intervals (95% CI) for estimating the association strength between genetic variations and phenotypes under different genetic models (codominant, dominant, recessive, and allele models). Additionally, linkage disequilibrium (LD) analysis was conducted, and haplotypes were inferred. LD indicates non-random associations between different loci, while haplotype construction reveals the combination patterns of gene variations and their distribution with the population.

Bioinformatics analysis

To investigate the impact of ASAP1 gene InDel variation sites on transcriptional activity, the AliBaba 2.1 website (http://gene-regulation.com/pub/programs/alibaba2/; accessed on 25 June 2024) was used to predict transcription factor binding sties within the intronic region harboring the InDel, and the differential transcription factors were marked with red triangles.

Nucleotide and protein sequences for six species (Capra hircus, Ovis aries, Bos taurus, Sus scrofa, Gallus gallus, and Homo sapiens) were obtained from the NCBI database (https://www.ncbi.nlm.nih.gov/; accessed on 27 July 2024). The MegAlign software ver. 7.2.0 was used to compare nucleotide sequence homology and the MEGA11 ver. 11 software (University Park) was used to construct a phylogenetic tree.

RESULTS

Expression levels of ASAP1 in testicular tissues of buck Shaanbei white cashmere goats infected/uninfected with Brucella

Testicular tissue samples were obtained from a 3-year-old Brucella positive buck and a healthy buck of the same age and breed. Quantitative analysis demonstrated that the expression level of the ASAP1 gene was significantly lower in the Brucella infected buck compared to the healthy control (p<0.01) (Figure 1).

Figure 1

Expression of ASAP1 in testicular tissues from 3-year-old male Shaanbei white cashmere goats with or without Brucella infection. Gene expression was quantified using the 2−ΔΔCT method normalized to GAPDH. Data are presented as mean±SEM (n = 3 biological replicates per group). NC indicates negative control; *** indicates p<0.001 by t-test. SEM, standard error of the mean.

Expression levels of the ASAP1 gene in various tissues of Shaanbei white cashmere goats

qRT-PCR results showed that the ASAP1 gene was expressed in all examined tissues of SBWC goats. The highest expression level was detected in the spleen, which was significantly higher than that in all other tissues (p<0.05) (Figure 2).

Figure 2

Tissue expression profile of the ASAP1 gene in healthy adult female goats. Gene expression was quantified using the 2−ΔΔCT method normalized to GAPDH. Values represent mean±SEM of three biological replicates. a–d Statistically significant differences (p<0.05) determined by one-way ANOVA with Tukey’s post hoc test are indicated by different letters. SEM, standard error of the mean.

Identification of ASAP1 gene insertion/deletion variants

Following verification by 3% agarose gel electrophoresis and sequencing, polymorphism was confirmed in three out of the ten selected ASAP1 gene intronic loci P2, P5 and P7 (Figure 3). Three genotypes insertion/insertion (II), insertion/deletion (ID), and deletion/deletion (DD) were identified at each of the variant loci P2 (Figure 3A), P5 (Figure 3B), and P7 (Figure 3C). The band sizes for the P2 locus corresponded to 317 bp (II), 317 bp and 300 bp (ID), and 300 bp (DD). For the P5 locus, the band sizes corresponded to 297 bp (II), 297 bp and 275 bp (ID), and 275 bp (DD). The P7 locus showed band sizes of 224 bp (II), 224 bp and 197 bp (ID), and 197 bp (DD). Notably, the sequences of the P2 and P5 loci differed from the predicted variant sequences in the Ensembl database. The InDel sequence obtained through actual sequencing was /AGTATTGTACTGTAATA which differed from the prediction for the P2 locus (TCGTCTGCGACGTGG). The InDel sequence of P5 locus obtained from actual result was GCAC GCTTGCATACATGTGCAC, which also differed from the prediction (TGCACATGTATGCAAGCGTGCC). In contrast, the sequence of P7 InDel locus matched the predicted sequence in the Ensembl database (Figure 3C).

Figure 3

Electrophoresis and sequencing diagrams of the goat ASAP1 gene InDel. (A) Electrophoresis and sequencing diagrams of the P2 mutation site. (B) Electrophoresis and sequencing diagrams of the P5 mutation site. (C) Electrophoresis and sequencing diagrams of the P7 mutation site. M: 600 bp marker (A, C); 2,000 bp marker (B); II, insertion/insertion, ID, insertion/deletion; DD, deletion/deletion.

Genetic parameter analysis of goat ASAP1 gene InDel

The genetic parameter results for the P2, P5 and P7 variant sites of the ASAP1 gene in SBWC goats are presented in Table 2. A total of 1133, 1054, and 1090 goat genomic samples were successfully genotyped at the P2, P5 and P7 loci, respectively. At the P2 and P7 loci, the frequency of the “I” allele was higher than that of the “D” allele, while the opposite pattern was observed at the P5 locus. Based on the PIC values, the P5 and P7 loci showed moderate polymorphism (0.25<PIC<0.50). In contrast, the P2 locus displayed moderate polymorphism (0.25<PIC<0.50) only in the case group, while it showed low polymorphism (PIC<0.25) in both the control group and the overall population. Additionally, the P2 locus conformed to HWE in the case group and the total population (p>0.05), but deviated from HWE in the control group (p<0.05). For the P5 and P7 loci, all groups conformed to HWE (p>0.05), with the exception of the P7 locus in the total population, which deviated significantly (p<0.05).

Genetic parameters of the P2, P5, and P7 loci of the goat ASAP1 gene

Distribution of genotypes and alleles at different ASAP1 gene variants in cases and controls

The genotypes and allele frequency distributions of the three ASAP1 gene varient sites in goats were analyzed statically. The result showed that the distribution frequencies of the three genotypes differed significantly between the case and control groups at the P2 and P7 sites (p<0.05), whereas no significant difference was observed for allele (p>0.05). At the P5 locus, neither the genotype nor allele distribution frequencies showed significant differences (p>0.05) (Table 3). These findings suggest that the P2 and P7 variant loci may be associated with resistance to Brucella infection.

Distribution of different genotypes and alleles of ASAP1 gene polymorphic sites in Brucella cases and controls

Age and parity as potential risk factors for Brucella infection in goats

To exclude potential confounding effects of age and parity on brucellosis risk, association analyses between these factors and Brucella infection were conducted. The analysis confirmed that neither age (Table 4) nor parity (Table 5) was significantly associated with Brucella infection risk in the studied population (p>0.05). Nevertheless, these non-significant variables were still incorporated into the final logistic regression models to ensure control for potential confounding effects and to improve the accuracy of the estimated associations between ASAP1 polymorphisms and infection status.

Association between age and brucellosis risk

Association between parity and brucellosis risk

Association analysis between ASAP1 gene polymorphism and resistance against brucellosis in goats

To investigate the association between the ASAP1 gene and resistance to brucellosis in goats, 4 genetic models (codominant, dominant, recessive, and allelic) were constructed. Logistic regression analysis was performed to evaluate the association of the P2, P5 and P7 loci with resistance. The results demonstrated that both the codominant (ID vs II) and dominant (ID+DD vs II) models at the P2 locus were significantly associated with a reduced risk of brucellosis when the II genotype was used as the reference. The OR were 0.723 (p = 0.017, 95% CI: 0.553–0.944) and 0.769 (p = 0.045, 95% CI: 0.595–0.994), respectively, suggesting that the II genotype confers susceptibility. In contrast, at the P7 locus, the codominant (ID vs II) and dominant (ID+DD vs II) models were significantly associated with an increased risk of brucellosis, with OR of 1.559 (p = 0.001, 95% CI: 1.210–2.008) and 1.462 (p = 0.050, 95% CI: 1.147–1.864), respectively. This indicates that the II genotype is associated with resistance. Furthermore, the p values from logistic regression models for the three InDel polymorphisms under different genetic models were corrected using the false discovery rate (FDR) method. The results indicated that the codominant models of loci P2 and P7, along with the dominant model of locus P7, remained statistically significant after FDR correction (FDR adjusted p<0.05) (Table 6).

Relationship between the genetic model of ASAP1 gene polymorphism sites and the risk of brucellosis

Linkage disequilibrium and haplotype association analysis of the InDel locus in goat ASAP1 gene

Analysis of the LD relationship among the three variant sites of the ASAP1 gene was conducted on the Gdicall website. The D′ and r2 values between sites P2 and P5 were 0.179 and 0.007, respectively; between P2 and P7, the values were 0.185 and 0.016, respectively; and between P5 and P7, the values were 0.620 and 0.036, respectively. These results indicate that no strong linkage exists among the variant sites P2, P5, and P7 (Figure 4).

Figure 4

LD between P2, P5, and P7 variant sites in the goat ASAP1 gene. (A) D′ value, (B) r2 value. LD, linkage disequilibrium.

Although the three loci were not in strong LD, haplotype analysis was still performed, supported by our gene expression date and based on the hypothesis of their potential functional complementarity in regulating ASAP1 expression. Using the P2, P5, and P7 variant sites, 8 haplotypes were constructed: IP2IP5IP7, IP2IP5DP7, IP2DP5IP7, IP2DP5DP7, DP2IP5IP7, DP2DP5IP7, DP2IP5DP7, and DP2DP5DP7. They analysis showed that the risks of brucellosis for haplotypes IP2DP5IP7 and DP2IP5IP7 were 0.761 and 0.657 times that of the IP2IP5IP7 haplotype (p = 0.035, 95% CI = 0.590–0.980; p = 0.016, 95% CI = 0.467–0.924), suggesting that IP2IP5IP7 is a susceptibility haplotype (Table 7).

Distribution of ASAP1 gene locus haplotypes in Brucella cases and controls

Changes in cytokine mRNA expression levels in peripheral blood mononuclear cells stimulated by lipopolysaccharide in vitro

Based on previous analysis findings in which Hap3 and Hap5 were associated with a significantly reduced risk of brucellosis in goats compared to Hap1 (p<0.05), the dynamic expression of cytokines in PBMCs/macrophages from goats with different haplotypes was further examined following LPS stimulation (Figure 5). The results showed that at 3 h and 24 h post-LPS stimulation, NF-κB expression in PBMCs from Hap3 and Hap5 was significantly higher than that in Hap1 (p<0.05) (Figure 5A), with similar trends observed at other time points. At 6 h and 12 h after LPS stimulation, IL-6 expression levels in Hap5 were significantly higher than those in Hap1 (p<0.05). Similarly, at 12 h and 24 h post-stimulation, IL-6 expression in Hap3 was also significantly elevated compared to Hap1 (p< 0.05) (Figure 5B). Throughout the 3–24 h period following LPS stimulation, TNF-α expression levels in PBMCs from Hap3 and Hap5 were consistently significantly higher than those in Hap1 (p<0.05) (Figure 5C). Furthermore, at 12 h and 24 h after LPS stimulation, significantly greater secretion of IFN-γ was observed in PBMCs from Hap3 and Hap5 (p<0.05) (Figure 5D). Additionally, TGF-β expression in PBMCs from Hap3 was significantly higher than in Hap1 from 1 h to 12 h after LPS stimulation (Figure 5E). Interestingly, LPS stimulation induced a consistently weaker inflammatory response in the susceptible Hap1 than in the resistant haplotypes (Hap3 and Hap5). Notably, after 6 h, the levels of inflammatory cytokines in Hap5 were, on average, lower than those in Hap3. This pattern suggests that the susceptible Hap1 haplotype mounts a diminished response to bacterial challenge, whereas the resistant haplotypes mount robust responses. Moreover, the most protective haplotype, Hap5, not only mounts a stronger inflammatory response but also resolves inflammation more rapidly, thus facilitating quicker restoration of immunological homeostasis. Following 24 h of LPS stimulation, the expression levels of ASAP1 PBMCs from Hap5 and Hap3 were significantly higher than those in Hap1 (Figure 5F). This observation is further supported by the similar expression pattern of ASAP1 in Brucella infected and uninfected testicular tissues.

Figure 5

Changes in cytokine expression in PBMCs from goats of different genotypes following LPS stimulation. Gene expression was quantified using the 2−ΔΔCT method normalized to GAPDH. (A–F) show the changes in the expression levels of cytokines such as NF-κB, IL-6, TNF-α, IFN-γ, TGF-β and ASAP1 at different time points after LPS stimulation across various haplotypes. n = 3; * p<0.05; ** p<0.01; *** p<0.001. PBMCs, peripheral blood mononuclear cells; LPS, lipopolysaccharide.

Transcription factor binding prediction

Prediction of transcription factor binding to the variant sites was performed (Supplement 1), the analysis revealed that, compared to the deleted sequence, the inserted sequence at the P2 site specifically bound the transcription factor MCM1 (Figure 6A; Supplement 2A), while the inserted sequence at the P7 site was specifically bound by the cAMP response element-binding protein (CREB) and the cytoplasmic polyadenylation element-binding protein (CPEB) (Figure 6B; Supplement 2B).

Figure 6

Predicted transcription factor binding sites at the P2 and P7 mutation sites of the goat ASAP1 gene. (A) Predicted differential transcription factors for the II and DD genotypes at the P2 locus: MCM1. (B) Predicted differential transcription factors for the II and DD genotypes at the P7 locus: CREB and CPEbind. Differential transcription factors are indicated by red triangles below. II, insertion/insertion; DD, deletion/deletion.

Gene conservation analysis

The results of MegAlign alignment for species homology showed that the nucleotide sequence of the goat ASAP1 gene exhibited the highest homology with Ovis aries (98.7%) and Bos taurus (96.3%), and the lowest homology with Homo sapiens (86.4%) and Gallus gallus (71.4%) (Supplement 3A). A phylogenetic tree of the protein was constructed using MEGA11 software, which revealed that the genetic distance between the goat ASAP1 gene and Bos taurus was the closest (Supplement 3B).

DISCUSSION

Brucella, a facultative intracellular Gram-negative bacterium, invades immune cells such as macrophages, thereby triggering a strong inflammatory response in the host. The ASAP1 gene functions to remodel the cytoskeleton by enhancing F-actin aggregation and increasing the formation of vinculin/paxillin plaques, thereby altering actin remodeling dynamics [10]. Evidence indicates that the endocytosis of M.tuberculosis H37Ra in THP-1 macrophages is achieved through the regulation of actin dynamics by the ASAP1 gene [10]. Notably, both M.tuberculosis and Brucella are intracellular bacterias that evade immune clearance and achieve intracellular proliferation through common mechanisms such as inhibiting phagosome-lysosome fusion and modulating autophagy pathways [15]. Genome-wide association studies have established that specific SNPs in the ASAP1 gene are significantly linked to human susceptibility to tuberculosis. In addition, ASAP1 expression was downregulated and DC migration was severely impaired following infection with M.tuberculosis [11], which prevented the effective activation of early T-cells and lead to a failure in establishing an adaptive immune response [16]. This has been identified as a key mechanism for host susceptibility to tuberculosis. Importantly consistent with findings in tuberculosis [11], our study found a significantly lower expression level of the ASAP1 gene in the testicular tissues of Brucella infected adult bucks compared to healthy controls. It has been reported that during Brucella infection, the effector protein BspF interacts with an Arf6 GTPase-activating protein (ACAP1), interfering with Arf6/Rab8a mediated membrane trafficking and causing abnormal accumulation of trans-golgi network (TGN) derived vesicles on the bacterium-containing vacuole (rBCV), thereby promoting bacterial replication [17]. ASAP1 and ACAP1 belong to the Arf-GAP protein family [17], but ASAP1 is uniquely characterized by an SH3 domain [18], which mediates protein-protein interaction networks by recognizing proline-rich motifs [19], and is widely involved in processes such as cell migration, proliferation, and cytoskeletal remodeling [19,20]. Although the functional importance of ASAP1 had been demonstrated in colorectal cancer [21], gastric cancer [20], and tuberculosis [11], its role in Brucella infection had not been reported.

This study represents the first report to systematically investigate the association between ASAP1 gene variations and Brucella infection risk in goats. The expression of ASAP1 was first analyzed across various goat tissues, This expression profile suggested a potential association of this gene with immune function in animals [22]. As a vital immune organ, the spleen is recognized as a primary defense against bacterial infections through the synergistic actions of innate immunity, adaptive immunity, and mechanical filtration [23]. Therefore, the high expression of the ASAP1 gene in this organ likely indicated a significant role in immune responses and pathogen clearance in goats. Evolutionary genetic analyses have indicated that positive selection pressure on host genes is closely associated with pathogen-driven adaptive evolution [24]. In the SBWC goat population, three InDel loci within the ASAP1 gene were found to display significant population genetic characteristics. We analyzed the genetic diversity and HWE of thise loci, among them, the P2 and P7 loci were predominantly characterized by the I allele, and distinct genotype distributions were observed between populations. The observed deviation from HWE at the control group in the P2 locus could be attributed to breeding practices intrinsic to commercial livestock management. Directed selection for economically important traits and non-random mating schemes (e.g., the extensive use of elite bucks) will systematically alter genotype frequencies, leading to deviations from HWE expectations [25]. Despite these population genetic deviations, the observed associations between ASAP1 InDels and brucellosis susceptibility were further supported by functional evidence from gene expression analyses.

Given that previous studies have often been limited by small sample sizes (N<500), this study provides reliable evidence for the association between ASAP1 gene polymorphisms and resistance/susceptibility of goats to Brucella infection through a large sample population (N>1,000). Due to the large sample size and associated cost constraints, confirmatory ELISA or PCR testing was not performed. However, it is acknowledged that the sole reliance on the RBPT for infection status classification constitutes a methodological limitation. Given that results based on RBPT do not exclude the possibility of false negatives or false positives, to improve reliability in the absence of confirmatory assays, all samples underwent repeated RBPT testing, and only those with consistently positive results were included in the infected group, which has substantially reduced the probability of false positives within the constraints of the available methodology. Prior to the genetic association analysis, the potential associations of age and parity with Brucella infection status were assessed in the selected samples. The confirmation of no significant associations for these covariates strengthened the validity of the genotypic results. It is acknowledged that environmental and management variables, including pen allocation and microenvironment, were not controlled for in this study. Nevertheless, all experimental animals were sourced from farms with standardized management, and the association between ASAP1 genotypes and infection status remained significant after adjusting for age and parity. The association analysis revealed that genotype II at the P2 locus was associated with susceptibility, whereas genotype II at the P7 locus was associated with resistance, suggesting that genotype distribution influences the response of goats to Brucella infection. Previous studies have indicated significant associations between genetic polymorphisms and increased or decreased to Brucella infection. In our earlier work, the cytotoxic T lymphocyte-associated antigen-4 (CTLA4) II genotype was shown to reduce brucellosis susceptibility in goats and enhance secretion of anti-inflammatory factors from PBMCs post-LPS challenge [26]. In our study, although no LD was detected among the three InDel loci, based on previous research in regulatory genomics, it has been proposed that combinations of genetic variants, even in the absence of strong linkage, could encompass multiple cis-regulatory modules (e.g., enhancers or silencers) and that their joint effects might co-regulate target gene expression through mechanisms such as chromatin spatial reorganization [27]. Furthermore, studies suggest that such combinatorial variation may influence transcription-factor networks and protein interactions, thereby potentially contributing to complex phenotypes like disease resistance in a synergistic manner [28]. Accordingly, we continue to explore the non-linked haplotype model from functional and regulatory perspectives. Therefore, PBMCs from goats with different haplotypes were stimulated with LPS. Observations suggested that PBMCs from goats carrying the Hap3 and Hap5 haplotypes tended to exhibit a more rapid initiation and resolution of the immune response following stimulation. These changes appeared to involve activation of the NF-κB pathway, relatively elevated expression levels of pro-inflammatory cytokines (IL-6 and TNF-α), and increased secretion of immunoregulatory factors (TGF-β and IFN-γ). At 24 h post-LPS stimulation, the NF-κB pathway showed indications of downregulation, and the concentrations of pro-inflammatory and immunoregulatory factors decreased. This response profile could potentially contribute to more effective control of infection. Furthermore, the expression level of ASAP1 at 24 h was significantly lower in haplotypes associated with high infection risk compared to those associated with low infection risk, which aligns with the downregulated expression trend of ASAP1 observed in infected animals. In Brucella infected testicular tissue expression was observed aligning directionally with our cellular assay results. However, given that the sample size was limited to n = 1 per group, this observation should be considered preliminary and does not constitute definitive evidence regarding the role of ASAP1 in goat Brucella infection. And the testicular tissue examined in this study serves as a primary reproductive organ target for Brucella infection, offering relevant pathophysiological insights. It should be noted, however, that sample collection from infected animals was highly restricted, and all animals in the main association cohort were female. Therefore, findings from this male tissue analysis should be interpreted as a reference for potential infection effects in reproductive organs. Overall, these three gene loci are genetically independent; based on our exploratory observations, they might collectively influence the immune phenotype when co-present. Nevertheless, the precise mechanisms underlying these phenotypic associations warrant further investigation.

Although the protein-coding region directly determined protein structure, gene expression can be regulated by mutations in non-coding regions through alteration of transcription factor binding affinity, a process that plays a significant role in the evolution of disease resistance traits [29]. Previous studies had shown that intron 3 of the mediator of IRF3 activation (MITA) gene was bound by the RNA binding protein LUC7L2, which leads to intron retention and the subsequent triggers nonsense-mediated mRNA decay (NMD), thereby reducing MITA protein levels and weakening the intensity of the innate immune response to DNA viruses [30]. Importantly, transcription factors including MCM1, CREB, and CPEB play crucial roles in regulating the immune cell cycle, immune gene expression, and cell migration [3133]. It should be emphasized that the transcription-factor binding sites (TFBS) predicted using AliBaba2 are based solely on in silico sequence analysis; these predictions are preliminary and do not confirm actual regulatory function, their specific mechanisms require further investigation. Considering that cattle, sheep, and humans are all major hosts of Brucella, and given the high expression of ASAP1 was observed in goat spleen in this study, a cross-species homology comparison was conducted. Phylogenetic analysis showed that the goat ASAP1 nucleotide sequence is highly conserved with Ovis aries (98.7%) and Bos taurus (96.3%), but less so with Gallus gallus (71.4%), indicating strong evolutionary conservation among ruminants, as reported in existing comparative genomic studies [34]. In summary, InDel variant in the ASAP1 gene were found to be associated with resistance to Brucella infection in goats, Goats carrying the low-disease-risk haplotype were shown to initiate immune responses more rapidly to combat bacterial infection and clear the pathogen. This outcome may be attributed either to potential functional interactions among the three variant sites or to the differential recruitment of transcription factors (such as MCM1), both of which could ultimately regulate gene function. However, given the high complexity of bacterial invasion and clearance, the precise molecular mechanisms were concluded to require further investigation.

CONCLUSION

Polymorphisms at three InDel loci within the ASAP1 gene were identified for the first time in the SBWC goat population, and their association with increased or decreased to Brucella infection was established. Under LPS stimulation, PBMCs from goats carrying the low-disease-risk haplotype exhibited a robust immune response and an accelerated termination of the immune response. The high-disease-risk haplotype exhibited lower ASAP1 levels, a pattern that matches the expression trend observed in tissues from Brucella-infected goats. This study elucidates the role of the ASAP1 gene in resistance to Brucella infection and provides potential target loci for the genetic breeding of brucellosis-resistant goats.

Notes

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

AUTHORS’ CONTRIBUTION

Conceptualization: Li Y.

Data curation: Liu X, Wang C.

Formal analysis: Liu X, Wang C.

Methodology: Liu X, Wang C, Ren X, Ren Z, Chen S.

Software: Ren X, Ren Z, Li R.

Validation: Li Y, Liu W.

Investigation: Ren X, Ren Z, Li R.

Writing - original draft: Liu X, Wang C.

Writing - review & editing: Liu X, Wang C, Ren X, Ren Z, Li Y, Liu W, Li R, Song X, Li H, Zhang L, Chen S, Du X, Hua J, Zhu H.

FUNDING

This work was supported by Key Area Project of the Shaanxi Provincial Department of Science and Technology (2025NC-YBXM-095), Natural Science Basic Research Program of Shaanxi Province (2024JC-YBQN-0239), Key Scientific Research Program Project of Shaanxi Provincial Department of Education (22JY075, 23JY087, 22JY074, 23JY090), Yulin Youth Talent Promotion Plan (20240601) and Doctoral Research Foundation of Yulin University (2023GK12, 2025GK22).

ACKNOWLEDGMENTS

Not applicable.

ETHICS APPROVAL

All animal procedures were approved by the Institutional Animal Care and Use Committee of Yulin University (YULLPZ-2025-003). Sample collection and other animal experiments were conducted in strict compliance with the guidelines of the Ethics Committee.

DECLARATION OF GENERATIVE AI

During the preparation of this manuscript, Liu X utilized the language polishing feature of ChatGPT-4 to enhance the readability and linguistic quality of the draft. Full responsibility for the final content of the published article is hereby declared. It was explicitly stated that the use of ChatGPT-4 was strictly confined to assisting with language refinement, with no involvement in any core academic activities, including but not limited to research design, data interpretation, or the derivation of research conclusions.

SUPPLEMENTARY MATERIAL

Supplementary file is available from: https://doi.org/10.5713/ab.250722

Supplement 1. Differential binding of transcription factors between II and DD genotypes at the P2 and P7 loci of the ASAP1 gene.

ab-250722-Supplementary-1.pdf

Supplement 2. Prediction of putative transcription factor binding sites at the P2 and P7 loci of the ASAP1 gene.

ab-250722-Supplementary-2.pdf

Supplement 3. Bioinformatics analysis of the goat ASAP1 gene.

ab-250722-Supplementary-3.pdf

DATA AVAILABILITY

Upon reasonable request, the datasets of this study can be available from the corresponding author.

References

1. Wallach JC, Samartino LE, Efron A, Baldi PC. Human infection by Brucella melitensis: an outbreak attributed to contact with infected goats. FEMS Immunol Med Microbiol 1997; 19 :315 –21. https://doi.org/10.1111/j.1574-695X.1997.tb01102.x.
2. Akoko JM, Pelle R, Lukambagire AS, et al. Molecular epidemiology of Brucella species in mixed livestock-human ecosystems in Kenya. Sci Rep 2021; 11 :8881. https://doi.org/10.1038/s41598-021-88327-z.
3. Khan MZ, Zahoor M. An overview of brucellosis in cattle and humans, and its serological and molecular diagnosis in control strategies. Trop Med Infect Dis 2018; 3 :65. https://doi.org/10.3390/tropicalmed3020065.
4. Laine CG, Johnson VE, Scott HM, Arenas-Gamboa AM. Global estimate of human brucellosis incidence. Emerg Infect Dis 2023; 29 :1789 –97. https://doi.org/10.3201/eid2909.230052.
5. Prajapati BM, Gupta JP, Pandey DP, Parmar GA, Chaudhari JD. Molecular markers for resistance against infectious diseases of economic importance. Vet World 2017; 10 :112 –20. https://doi.org/10.14202/vetworld.2017.112-120.
6. Wijayanti D, Bai Y, Hanif Q, et al. Goat CLSTN2 gene: tissue expression profile, genetic variation, and its associations with litter size. Anim Biotechnol 2023; 34 :2674 –83. https://doi.org/10.1080/10495398.2022.2111311.
7. Liu J, Xu L, Ding X, Ma Y. Genome-wide association analysis of reproductive traits in Chinese Holstein cattle. Genes 2024; 15 :12. https://doi.org/10.3390/genes15010012.
8. Chen PW, Jian X, Heissler SM, et al. The Arf GTPase-activating protein, ASAP1, binds nonmuscle myosin 2A to control remodeling of the actomyosin network. J Biol Chem 2016; 291 :7517 –26. https://doi.org/10.1074/jbc.M115.701292.
9. Xu H, Qiu Q, Hu P, et al. MSUT2 regulates tau spreading via adenosinergic signaling mediated ASAP1 pathway in neurons. Acta Neuropathol 2024; 147 :55. https://doi.org/10.1007/s00401-024-02703-3.
10. Cui J, Chen G, Zhao Z, et al. ASAP1 regulates the uptake of Mycobacterium tuberculosis H37Ra in THP1-derived macrophages by remodeling actin cytoskeleton. Tuberculosis 2021; 129 :102090. https://doi.org/10.1016/j.tube.2021.102090.
11. Curtis J, Luo Y, Zenner HL, et al. Susceptibility to tuberculosis is associated with variants in the ASAP1 gene encoding a regulator of dendritic cell migration. Nat Genet 2015; 47 :523 –7. https://doi.org/10.1038/ng.3248.
12. Smith JA. Brucella lipopolysaccharide and pathogenicity: the core of the matter. Virulence 2018; 9 :379 –82. https://doi.org/10.1080/21505594.2017.1395544.
13. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2–ΔΔCT method. Methods 2001; 25 :402 –8. https://doi.org/10.1006/meth.2001.1262.
14. Nei M. Analysis of gene diversity in subdivided populations. Proc Natl Acad Sci U S A 1973; 70 :3321 –3. https://doi.org/10.1073/pnas.70.12.3321.
15. Ali A, Waris A, Khan MA, et al. Recent advancement, immune responses, and mechanism of action of various vaccines against intracellular bacterial infections. Life Sci 2023; 314 :121332. https://doi.org/10.1016/j.lfs.2022.121332.
16. Sallusto F, Lenig D, Förster R, Lipp M, Lanzavecchia A. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature 1999; 401 :708 –12. https://doi.org/10.1038/44385.
17. Borghesan E, Smith EP, Myeni S, et al. A Brucella effector modulates the Arf6-Rab8a GTPase cascade to promote intravacuolar replication. EMBO J 2021; 40 :EMBJ2021107664. https://doi.org/10.15252/embj.2021107664.
18. Gasilina A, Vitali T, Luo R, Jian X, Randazzo PA. The ArfGAP ASAP1 controls actin stress fiber organization via its N-BAR domain. iScience 2019; 22 :166 –80. https://doi.org/10.1016/j.isci.2019.11.015.
19. Kurochkina N, Guha U. SH3 domains: modules of protein–protein interactions. Biophys Rev 2013; 5 :29 –39. https://doi.org/10.1007/s12551-012-0081-z.
20. Xie W, Han Z, Zuo Z, et al. ASAP1 activates the IQGAP1/CDC42 pathway to promote tumor progression and chemotherapy resistance in gastric cancer. Cell Death Dis 2023; 14 :124. https://doi.org/10.1038/s41419-023-05648-9.
21. Müller T, Stein U, Poletti A, et al. ASAP1 promotes tumor cell motility and invasiveness, stimulates metastasis formation in vivo, and correlates with poor survival in colorectal cancer patients. Oncogene 2010; 29 :2393 –403. https://doi.org/10.1038/onc.2010.6.
22. Schnell S, Démollière C, van den Berk P, Jacobs H. Gimap4 accelerates T-cell death. Blood 2006; 108 :591 –9. https://doi.org/10.1182/blood-2005-11-4616.
23. Lewis SM, Williams A, Eisenbarth SC. Structure and function of the immune system in the spleen. Sci Immunol 2019; 4 :eaau6085. https://doi.org/10.1126/sciimmunol.aau6085.
24. Shafer ABA, Fan CW, Côté SD, Coltman DW. Lack of) genetic diversity in immune genes predates glacial isolation in the North American mountain goat (Oreamnos americanus). J Hered 2012; 103 :371 –9. https://doi.org/10.1093/jhered/esr138.
25. Yao Z, Zhang S, Wang X, et al. Genetic diversity and signatures of selection in BoHuai goat revealed by whole-genome sequencing. BMC Genomics 2023; 24 :116. https://doi.org/10.1186/s12864-023-09204-9.
26. Wang C, Liu X, Ren Z, et al. The goat cytotoxic T lymphocyte-associated antigen-4 gene: mRNA expression and association analysis of insertion/deletion variants with the risk of brucellosis. Int J Mol Sci 2024; 25 :10948. https://doi.org/10.3390/ijms252010948.
27. Saint Just Ribeiro M, Tripathi P, Namjou B, Harley JB, Chepelev I. Haplotype-specific chromatin looping reveals genetic interactions of regulatory regions modulating gene expression in 8p23.1. Front Genet 2022; 13 :1008582. https://doi.org/10.3389/fgene.2022.1008582.
28. Karpova N, Dmitrenko O, Arshinova E. In silico determination of changes in transcription factor binding sites for the preeclampsia risk haplotype in the regulatory region of the FLT1 gene. Biol Life Sci Forum 2022. 20 p. 31. https://doi.org/10.3390/IECBM2022-13721.
29. Yan J, Qiu Y, Ribeiro dos Santos AM, et al. Systematic analysis of binding of transcription factors to noncoding variants. Nature 2021; 591 :147 –51. https://doi.org/10.1038/s41586-021-03211-0.
30. Li C, Feng L, Luo WW, Lei CQ, Li M, Shu HB. The RNA-binding protein LUC7L2 mediates MITA/STING intron retention to negatively regulate innate antiviral response. Cell Discov 2021; 7 :46. https://doi.org/10.1038/s41421-021-00277-y.
31. Althoefer H, Schleiffer A, Wassmann K, Nordheim A, Ammerer G. Mcm1 is required to coordinate G2-specific transcription in Saccharomyces cerevisiae. Mol Cell Biol 1995; 15 :5917 –28. https://doi.org/10.1128/MCB.15.11.5917.
32. Aziz M, Holodick NE, Rothstein TL, Wang P. B-1a cells protect mice from sepsis: critical role of CREB. J Immunol 2017; 199 :750 –60. https://doi.org/10.4049/jimmunol.1602056.
33. Fernández-Miranda G, Méndez R. The CPEB-family of proteins, translational control in senescence and cancer. Ageing Res Rev 2012; 11 :460 –72. https://doi.org/10.1016/j.arr.2012.03.004.
34. Bickhart DM, Rosen BD, Koren S, et al. Single-molecule sequencing and chromatin conformation capture enable de novo reference assembly of the domestic goat genome. Nat Genet 2017; 49 :643 –50. https://doi.org/10.1038/ng.3802.

Article information Continued

Figure 1

Expression of ASAP1 in testicular tissues from 3-year-old male Shaanbei white cashmere goats with or without Brucella infection. Gene expression was quantified using the 2−ΔΔCT method normalized to GAPDH. Data are presented as mean±SEM (n = 3 biological replicates per group). NC indicates negative control; *** indicates p<0.001 by t-test. SEM, standard error of the mean.

Figure 2

Tissue expression profile of the ASAP1 gene in healthy adult female goats. Gene expression was quantified using the 2−ΔΔCT method normalized to GAPDH. Values represent mean±SEM of three biological replicates. a–d Statistically significant differences (p<0.05) determined by one-way ANOVA with Tukey’s post hoc test are indicated by different letters. SEM, standard error of the mean.

Figure 3

Electrophoresis and sequencing diagrams of the goat ASAP1 gene InDel. (A) Electrophoresis and sequencing diagrams of the P2 mutation site. (B) Electrophoresis and sequencing diagrams of the P5 mutation site. (C) Electrophoresis and sequencing diagrams of the P7 mutation site. M: 600 bp marker (A, C); 2,000 bp marker (B); II, insertion/insertion, ID, insertion/deletion; DD, deletion/deletion.

Figure 4

LD between P2, P5, and P7 variant sites in the goat ASAP1 gene. (A) D′ value, (B) r2 value. LD, linkage disequilibrium.

Figure 5

Changes in cytokine expression in PBMCs from goats of different genotypes following LPS stimulation. Gene expression was quantified using the 2−ΔΔCT method normalized to GAPDH. (A–F) show the changes in the expression levels of cytokines such as NF-κB, IL-6, TNF-α, IFN-γ, TGF-β and ASAP1 at different time points after LPS stimulation across various haplotypes. n = 3; * p<0.05; ** p<0.01; *** p<0.001. PBMCs, peripheral blood mononuclear cells; LPS, lipopolysaccharide.

Figure 6

Predicted transcription factor binding sites at the P2 and P7 mutation sites of the goat ASAP1 gene. (A) Predicted differential transcription factors for the II and DD genotypes at the P2 locus: MCM1. (B) Predicted differential transcription factors for the II and DD genotypes at the P7 locus: CREB and CPEbind. Differential transcription factors are indicated by red triangles below. II, insertion/insertion; DD, deletion/deletion.

Table 1

Goat ASAP1 gene InDel detection and qRT-PCR primer pairs

Primer Information Primer sequence (5′–3′) Length (bp) Tm (°C) Function
P1 rs642042901
chr14:71401052–71401053
F: GCCTTAGCCTTGAGTAGCCC
R: AAACAGCACAGCATCCCAGT
294/318 60 Indel detection
P2 rs655531471
chr14:71407951–71407952
F: TTTGAAAACTTCGGGCCGC
R: TGGGGACGACAACATAAAGCA
300/317 59 Indel detection
P3 rs672114848
chr14:71396371–71396396
F: CTCACGGTTTCTGTTCCCCC
R: AACTCAGACTTCACAGGCTGG
203/229 60 Indel detection
P4 rs668680239
chr14:71400612–71400627
F: CCTGAGAACCAAGCTGTTTGC
R: TCTTCTTGACGCCCTTCCCT
272/288 60 Indel detection
P5 rs680105692
chr14:71401507–71401528
F: TCAAACGCCACAGTCAACAC
R: CTTGGAAGCATCTCACACGG
275/297 59 Indel detection
P6 rs644524287
chr14:71413164–71413163
F: TGAGCCAGTCCTCAGGTTTAT
R: CCCAGACCCACCTACCGTT
212/232 58 Indel detection
P7 rs652252293
chr14:71446770–71446796
F: CAGGTTCACCATTTGCCTGG
R: TTTCCAGCGTGTGTAGCAGA
197/224 59 Indel detection
P8 rs660459809
chr14:71451546–71451561
F: CTCACATCGTGGCATTTCTCC
R: CAAAGCAAAGCTGAAGGGATG
152/168 58 Indel detection
P9 rs667148743
chr14:71660926–71660927
F: ACAGGAACTGTGTTCCACGAA
R: CTAAAGGGAAGGGGAAACTGCT
222/234 59 Indel detection
P10 rs652089744
chr14:71496979–71496996
F: GTCATTGTCTTCGCTTGCTT
R: ATGGGTCTGATCCCTGGTTT
229/247 56 Indel detection
GAPDH NC_030812.1 F: AAAGTGGACATCGTCGCCAT
R: CCGTTCTCTGCCTTGACTGT
116 60 qRT-PCR
ASAP1 NC_030821.1 F: ATGCAGAGGGGGTGGAGTTA
R: GCCGTCTGCTTATCCAGGTT
157 60 qRT-PCR
NF-κB NC_030821.1 F: TGGGGATACTGAACAACGCC
R: ATCTGTCTCAGGGCCTCCAT
115 60 qRT-PCR
IL-6 NC_030821.1 F: TTCAGTCCACTCGCTGTCTC
R: TGCTTGGGGTGGTGTCATTC
106 60 qRT-PCR
TNF-α NC_030821.1 F: AACCCATCTACCAGGGAGGG
R: AGTAGACCTGCCCAGACTCA
108 60 qRT-PCR
IFN-γ NC_030821.1 F: AGATCCAGCGCAAAGCCATA
R: TCTCCGGCCTCGAAAGAGAT
110 60 qRT-PCR
TGF-β NC_030821.1 F: AACAATTCCTGGCGCTACCT
R: ACTGAGGCGAAAGCCCTCTA
135 60 qRT-PCR

qRT-PCR, quantitative reverse transcription-polymerase chain reaction.

Table 2

Genetic parameters of the P2, P5, and P7 loci of the goat ASAP1 gene

Loci Sample Number Genotype frequency Allele frequency Genetic parameters HWE

N II ID DD I D Ho He Ne PIC p-value
P2 Case 444 0.658 (292) 0.311 (138) 0.031 (14) 0.813 0.187 0.696 0.304 1.437 0.258 p>0.05
Control 689 0.714 (492) 0.244 (168) 0.042 (29) 0.836 0.164 0.726 0.274 1.378 0.237 p<0.05
Sum 1,133 0.692 (784) 0.270 (306) 0.038 (43) 0.827 0.173 0.714 0.286 1.401 0.245 p>0.05
P5 Case 406 0.241 (98) 0.483 (196) 0.276 (11) 0.483 0.517 0.501 0.499 1.998 0.354 p>0.05
Control 648 0.247 (160) 0.494 (320) 0.259 (16) 0.494 0.506 0.500 0.500 2.000 0.353 p>0.05
Sum 1,054 0.245 (258) 0.490 (516) 0.265 (280) 0.490 0.510 0.500 0.500 1.999 0.375 p>0.05
P7 Case 446 0.514 (229) 0.401 (179) 0.085 (38) 0.714 0.286 0.592 0.408 1.690 0.325 p>0.05
Control 644 0.419 (270) 0.511 (329) 0.070 (45) 0.675 0.325 0.561 0.439 1.782 0.342 p>0.05
Sum 1,090 0.458 (499) 0.466 (508) 0.076 (83) 0.691 0.309 0.573 0.427 1.746 0.336 p<0.05

N, number; II, insertion/insertion; ID, insertion/deletion; DD, deletion/deletion; I, insertion; D, deletion; Ho, homozygosity; He, heterozygosity; Ne, effective number of alleles; PIC, polymorphism information; HWE, Hardy-Weinberg equilibrium.

Table 3

Distribution of different genotypes and alleles of ASAP1 gene polymorphic sites in Brucella cases and controls

Loci Genotype/allele Genotype/allele frequency χ2 p-value

Case Control
P2 II 0.658 (292) 0.714 (492) 6.520 0.038
ID 0.311 (138) 0.244 (168)
DD 0.032 (14) 0.042 (29)
I 0.813 (722) 0.835 (1,152) 1.985 0.159
D 0.187 (166) 0.164 (226)
P5 II 0.241 (98) 0.247 (160) 0.353 0.838
ID 0.483 (196) 0.484 (320)
DD 0.276 (112) 0.259 (168)
I 0.483 (392) 0.494 (640) 0.245 0.621
D 0.517 (420) 0.506 (656)
P7 II 0.514 (229) 0.419 (270) 12.703 0.002
ID 0.401 (179) 0.511 (329)
DD 0.085 (38) 0.070 (45)
I 0.714 (637) 0.675 (869) 3.837 0.050
D 0.286 (255) 0.325 (419)

p<0.05, significant difference.

II, insertion/insertion; ID, insertion/deletion; DD, deletion/deletion.

Table 4

Association between age and brucellosis risk

Loci Age Frequencies p-value OR (95% CI)

Case Control
P2 3 260 (0.586) 420 (0.610) 1.00
4 140 (0.315) 200 (0.290) 0.577 0.884 (0.574–1.362)
5 44 (0.099) 69 (0.100) 0.951 0.976 (0.455–2.095)
P5 3 242 (0.596) 395 (0.610) 1.00
4 124 (0.305) 188 (0.290) 0.723 0.922 (0.588–1.445)
5 40 (0.099) 65 (0.100) 0.980 0.990 (0.447–2.193)
P7 3 263 (0.590) 393 (0.610) 1.00
4 138 (0.309) 187 (0.290) 0.657 0.906 (0.586–1.401)
5 45 (0.101) 64 (0.099) 0.862 0.934 (0.431–2.020)

p<0.05, significant difference.

OR, odds ratio; CI, confidence interval.

Table 5

Association between parity and brucellosis risk

Loci Parity Frequencies p-value OR (95% CI)

Case Control
P2 2 208 (0.468) 336 (0.488) 1.00
3 150 (0.338) 224 (0.325) 1.000 1.000 (0.679–1.472)
4 68 (0.153) 101 (147) 1.000 1.000 (0.544–1.840)
5 18 (0.041) 28 (0.041) 0.978 0.986 (0.370–2.633)
P5 2 194 (0.596) 316 (0.488) 1.00
3 135 (0.305) 211 (0.326) 0.960 1.010 (0.677–1.509)
4 61 (0.150) 95 (0.147) 0.981 1.008 (0.533–1.907)
5 16 (0.039) 26 (0.040) 0.988 1.008 (0.361–2.812)
P7 2 210 (0.471) 314 (0.488) 1.00
3 150 (0.336) 210 (0.326) 0.987 0.997 (0.675–1.471)
4 68 (0.152) 94 (0.146) 0.979 1.008 (0.543–1.872)
5 18 (0.040) 26 (0.040) 0.946 1.035 (0.383–2.795)

p<0.05, significant difference.

OR, odds ratio; CI, confidence interval.

Table 6

Relationship between the genetic model of ASAP1 gene polymorphism sites and the risk of brucellosis

Loci Genetic models Genotype/allele Frequencies OR (95% CI) p-value FDR-adjusted p-value

Positive Negative
P2 Co-dominant II 0.658 (292) 0.714 (492) 1.00
ID 0.311 (138) 0.244 (168) 0.723 (0.553–0.944) 0.017 0.0425
DD 0.032 (14) 0.042 (29) 1.229 (0.639–2.365) 0.536 0.5360
Dominant II 0.658 (292) 0.714 (492) 1.00
ID+DD 0.342 (152) 0.286 (197) 0.769 (0.595–0.994) 0.045 0.0750
Recessive II+ID 0.968 (430) 0.958 (660) 1.00
DD 0.032 (14) 0.042 (29) 1.350 (0.705–2.583) 0.366 0.4575
Alleles I 0.813 (722) 0.835 (1,152) 1.00
D 0.187 (166) 0.164 (226) 0.853 (0.684–1.064) 0.159 0.2650
P5 Co-dominant II 0.241 (98) 0.247 (160) 1.00
ID 0.483 (196) 0.484 (320) 1.000 (0.735–1.361) 1.000 1.000
DD 0.276 (112) 0.259 (168) 0.919 (0.649–1.300) 0.632 1.000
Dominant II 0.241 (98) 0.247 (160) 1.00
ID+DD 0.759 (308) 0.753 (488) 0.970 (0.727–1.296) 0.839 1.000
Recessive II+ID 0.724 (294) 0.741 (480) 1.00
DD 0.276 (112) 0.259 (168) 0.919 (0.695–1.215) 0.553 1.000
Alleles I 0.483 (392) 0.494 (640) 1.00
D 0.517 (420) 0.506 (656) 0.957 (0.803–1.140) 0.621 1.000
P7 Co-dominant II 0.514 (229) 0.419 (270) 1.00
ID 0.401 (179) 0.511 (329) 1.559 (1.210–2.008) 0.001 0.005
DD 0.085 (38) 0.070 (45) 1.004 (0.630–1.601) 0.985 0.985
Dominant II 0.514 (229) 0.419 (270) 1.00
ID+DD 0.487 (217) 0.581 (374) 1.462 (1.147–1.864) 0.002 0.005
Recessive II+ID 0.915 (408) 0.930 (599) 1.00
DD 0.085 (38) 0.070 (45) 0.807 (0.514–1.265) 0.349 0.436
Alleles I 0.714 (637) 0.675 (869) 1.00
D 0.286 (255) 0.325 (419) 1.204 (1.000–1.451) 0.050 0.050

p<0.05, significant difference.

OR, odds ratio; CI, confidence interval; FDR, false discovery rate; II, insertion/insertion; ID, insertion/deletion; DD, deletion/deletion.

Table 7

Distribution of ASAP1 gene locus haplotypes in Brucella cases and controls

Haplotypic names Haplotypic types Haplotypic frequencies p-value OR (95% CI)

Positive Negative
Hap1 IP2IP5IP7 149 (0.188) 263 (0.221) 1.00
Hap2 IP2IP5DP7 140 (0.176) 209 (0.176) 0.263 0.846 (0.631–1.134)
Hap3 IP2DP5IP7 280 (0.354) 376 (0.316) 0.035 0.761 (0.590–0.980)
Hap4 IP2DP5DP7 70 (0.088) 140 (0.118) 0.485 1.133 (0.798–1.608)
Hap5 DP2IP5IP7 94 (0.118) 109 (0.092) 0.016 0.657 (0.467–0.924)
Hap6 DP2DP5IP7 44 (0.056) 62 (0.052) 0.311 0.798 (0.516–1.234)
Hap7 DP2IP5DP7* 3 (0.004) 0 (0.000) - -
Hap8 DP2DP5DP7* 13 (0.016) 29 (0.024) - -

p<0.05, significant difference.

*

All frequencies below 0.03 were ignored in this analysis.

OR, odds ratio; CI, confidence interval.