Effects of the <i>DUSP6</i> gene on the proliferation and differentiation of porcine subcutaneous preadipocytes

Xiangxiang Yang; Xiaohan Sun; Zimeng Du; Jundong Yi; Qiuyan Wang; Ding Yin; Yalan Zhang; Xiaoling Ding; Xianrui Zheng; Xiaodong Zhang; Zongjun Yin; Yueyun Ding

doi:10.5713/ab.25.0175

Anim Biosci > Volume 38(12); 2025 > Article

Yang, Sun, Du, Yi, Wang, Yin, Zhang, Ding, Zheng, Zhang, Yin, and Ding: Effects of the DUSP6 gene on the proliferation and differentiation of porcine subcutaneous preadipocytes

Article

Animal Breeding and Genetics

Animal Bioscience 2025; 38(12): 2558-2567.

Published online: June 24, 2025

https://doi.org/10.5713/ab.25.0175

Effects of the DUSP6 gene on the proliferation and differentiation of porcine subcutaneous preadipocytes

Xiangxiang Yang^1,²

, Xiaohan Sun^1,²

, Zimeng Du^1,²

, Jundong Yi^1,²

, Qiuyan Wang^1,²

, Ding Yin^1,²

, Yalan Zhang^1,²

, Xiaoling Ding^1,²

, Xianrui Zheng^1,²

, Xiaodong Zhang^1,²

, Zongjun Yin^1,^2,^*

, Yueyun Ding^1,^2,^*

¹College of Animal Science and Technology, Anhui Agricultural University, Hefei, China

²Anhui Province Key Laboratory of Local Livestock and Poultry Genetic Resource Conservation and Bio-Breeding, Anhui Agricultural University, Hefei, China

^*Corresponding Author: Zongjun Yin,
Tel: +86-551-65786303, E-mail: yinzongjun@ahau.edu.cn. Yueyun Ding,
Tel: +86-13966675382, E-mail: dingyueyun@ahau.edu.cn

Received March 16, 2025 Revised April 24, 2025 Accepted June 17, 2025

This is an open-access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Objective

Dual-specificity protein phosphatase 6 (DUSP6), also known as mitogen-activated protein kinase phosphatase 3 (MKP-3), was considered as a functional candidate gene for white fat accumulation in mice. However, the physiological function of the DUSP6 gene on white adipocyte adipogenesis in farm animals remains unknown. In this study, we aimed to clarify the effect of DUSP6 on porcine subcutaneous preadipocyte proliferation and differentiation.

Methods

We first make clear that the patterns of DUSP6 expression is associated with fat contents in porcine fat deposition related tissues. Porcine subcutaneous preadipocytes were isolated and induced to differentiation. Small interfering RNAs were applied to deplete DUSP6. MTT assay, CCK-8 analysis, Oil Red O staining, triglyceride determination and reverse transcription quantitative polymerase chain reaction were applied to study the regulatory role of DUSP6 during adipocyte adipogenesis in pigs.

Results

We found that the expression levels of DUSP6 were significantly higher in backfat and longissimus dorsi tissues from fat-type pigs than in those from lean-type pigs. Consistently, the significantly induced expression of DUSP6 was also observed in differentiated adipocytes. In addition, knockdown of DUSP6 greatly inhibited preadipocytes proliferation, through the decreased cell viability and downregulated mRNA expressions of cell proliferation-associated genes, including PCNA, CDK1, CDK2. Furthermore, knockdown of DUSP6 significantly inhibited preadipocytes differentiation, as evidenced by markedly reduced lipid droplet formation, attenuated triglyceride accumulation and downregulated expression levels of adipogenic transcription masters (PPARγ, C/EBPβ, FASN and FABP4) in DUSP6 knockdown cells.

Conclusion

Our results demonstrate that DUSP6 is required for white adipocyte adipogenesis in pigs.

Keywords: Cell Proliferation and Differentiation; DUSP6; Pig; Preadipocytes

INTRODUCTION

Over the past few decades, obesity has become a significant global health challenge with a rapidly rising incidence. Obesity represents a complex, heterogeneous, chronic, and progressive disease [1], leading to severe conditions such as hypertension, hyperlipidemia, Type 2 diabetes, stroke, metabolic syndrome, asthma, and cancer [2], which contribute to an increase in morbidity and mortality. Urgent and sustained attention of obesity-related health risks are most warranted [3]. As the burden of obesity is increasing steadily, its direct and indirect costs to society are substantially immense [4].

Obesity is thought to be due to the excessive accumulation of white adipose tissue [5]. Adipose tissue expansion and development occur through increasing in the number of preadipocytes, as well as differentiation of preadipocytes into mature adipocytes capable of triglyceride (TG) storage, metabolism, production of adipokines, which is known as adipogenesis [6]. Thus, the proliferation and differentiation of preadipocytes in white fat tissue are contributed to adipose tissue development and even body weight gain. In addition, adipose tissue deposition is highly correlated with meat quality and production efficiency in farm animals [7–9]. Pigs are the most important meat livestock worldwide. Fat deposition-related traits, including backfat thickness, carcass leanness, feed efficiency, and meat quality, are of economic importance in swine breeding [10,11]. Meanwhile, pigs are not only similar to humans in terms of the anatomy and physiology of the cardiovascular, but also exhibit a high degree of similarity in the process of lipid metabolism, that is widely used to investigate the mechanism of fat deposition and obesity [12]. Therefore, the exploration mechanism of porcine preadipocyte proliferation and differentiation has significant implications for human obesity-related diseases and pig breeding production.

The process of preadipocytes proliferation and differentiation is a change in gene expression patterns. Intensive efforts have been made to reveal the genetic basis of adipogenesis, especially in terms of differentiation, and several central transcription factors (TFs) including peroxisome proliferator-activated receptor γ (PPARγ), CCAAT/enhancer-binding protein (C/EBP) α, β, δ, and lipogenic-related genes including fatty acid binding protein 4 (FABP4) and fatty acid synthase (FASN), have been characterized as the master adipogenic markers [13,14]. However, adipogenesis is a tightly orchestrated cellular differentiation process regulated by a cascade of TFs; the regulatory network of adipogenesis is far from complete. Alternatively, other studies have also shown that many regulatory genes, such as PABPN1 [15], E2F5 [16], and ADAR1 [17], can regulate adipocyte development. Thus, identification of the involved genes and networks, as well as exploration of the genetic regulatory mechanisms that control porcine adipogenesis, is required to better understand fat deposition in pigs.

Dual-specificity protein phosphatase 6 (DUSP6), also known as mitogen-activated protein kinase phosphatase-3 (MKP-3), is a member of the dual-specificity protein phosphatases (DUSPs) family [18]. By interacting with multiple nodes of Notch1 [19], CYP4A [20], MAPK and PI3K/AKT signaling pathways [21], DUSP6 is involved in modulating diverse cellular processes, such as cell growth, proliferation, differentiation, migration, invasion, metabolism (lipid accumulation in HepG2 cells) [19–22]. It is also associated with the pathological processes of obesity [23], nonalcoholic fatty liver [20], cognitive impairment [21], and multiple types of cancers [22]. Unlike its dual manner functions, pro-oncogenic or tumor-suppressive, in the pathological processes of cancers, the positive function of DUSP6 in white adipocyte adipogenesis is reported. Mice lacking DUSP6/8 have enhanced resistance to diet-induced obesity, with the dramatically reduced serum TG, lipid content in the liver and visceral adipose tissues [24]. DUSP6 mRNA level has been previously reported to increase in white adipose tissue of ob/ob and db/db mice [25]. The level of DUSP6 protein expression significantly increases at the early stage of 3T3-L1 adipogenesis (2 days after induction); DUSP6 deficiency is further linked with impaired in vitro adipocyte differentiation in a subline of 3T3-L1 and in the isolated preadipocytes (the stromal vascular cells isolated from gonadal adipose tissue of Dusp6−/−mice) [26]. However, the molecular mechanism of DUSP6 deficiency in inhibiting white adipocyte differentiation is not fully understood. Furthermore, little is known on the actual role of DUSP6 in white preadipocyte adipogenesis in farm animals, and further study is warranted.

It is thought that DUSP6 may play a crucial role in white adipose accumulation. Herein, the aims of this study were to: (1) identity the growth curve and differentiation ability of primary subcutaneous preadipocytes cultured from newborn Huoshou black piglets; (2) detect the expression patterns of the DUSP6 gene in the fat deposition related tissues from fat-type and lean-type pigs, and in differentiating preadipocytes; (3) examine the effects on the proliferation and differentiation of preadipocytes after knockdown of the DUSP6 gene. In this study, we initially investigated the DUSP6 gene effect on the porcine adipocyte adipogenesis to provide scientific clues for the improvement of pig meat quality and the treatment of obesity-related diseases.

MATERIALS AND METHODS

Sample collection for reverse transcription quantitative polymerase chain reaction analysis

Our research was approved by the Anhui Agricultural University Animal Ethics Committee under permission No. KKLL2025014. Backfat and longissimus dorsi tissues of 5 Youhulu type Huoshou Black (fat type) and 5 Landrace finishing female pigs (lean type) with similar body weights (113.00± 7.24 kg, n = 10), with extremely divergent back fat thickness and IMF (45.36 mm±3.80 vs. 26.00 mm±1.63, n = 5, p<0.01; 8.54%±0.31 vs. 2.53 %±0.14, n = 5, p<0.01), were collected and kept in our lab at −80°C until further use for reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis.

Cell isolation, culture, induction differentiation, and transfection

Preadipocytes were isolated from 3-day-old Huoshou black piglets as follows. Under sterile conditions, subcutaneous adipose tissues from the back and neck of piglets were collected and washed three times using PBS containing 5% penicillin/streptomycin (Gibco). The adipose tissue samples were then sheared into pieces, and were sufficiently digested with collagenase Type I (Solarbio) at 37°C for 1 h. After digestion, the mixture was filtered to remove the undigested fractions, and then centrifuged at 1,500 r/min for 10 min to obtain the preadipocytes. The preadipocytes were then resuspended and seeded in the complete medium comprising 89% DMEM/F12 (Gibco), 10% FBS (Gibco) and 1% penicillin/streptomycin. The cells were then incubated at 37°C in a cell culture incubator using 5% CO₂. Culture medium was changed every 2 days.

To induce differentiation, 2 days after confluence, cells were supplied with differentiation medium (DMEM/F12 containing 10 % FBS plus 5 μg/mL insulin [Solarbio], 1 μM dexamethasone [Solarbio], 0.5 mM IBMX [Solarbio]) for 2 days, and then cultured in maintain medium (DMEM/F12 containing 10 % FBS plus 5 μg/mL insulin) for another 6 days, and medium was replaced every 2 days. The adipogenic differentiation spanned around 8 days.

For DUSP6 knockdown, cells at 60% confluence were transfected by small-interfering RNAs (siRNAs) or negative control (NC) using the Lipofectamine 2000 transfection kit (Invitrogen) according to the manufacturer’s instructions. The siRNAs used in this study were designed by GenePharma and contained three DUSP6 gene siRNA sequences and an siRNA NC (Table 1).

MTT assays measure the growth curve of primary cultured preadipocytes

Pig subcutaneous preadipocyte proliferative capacity was examined by performing MTT assays on 1, 2, 3, 5, 7, 9, 11, 13 days after cell attachment. Cells were seeded into 96-well plates at a density of 5,000 cells/well. Firstly, 10 μL of prepared 5mg/mL MTT solution was added and incubated at 37°C and 5% CO₂ for 4 h. Then, MTT solution was discarded and 100 μL of DMSO was added to the wells for mixing. Finally, optical density values were subsequently measured at 490 nm using a microplate reader (Thermo Fisher Scientific).

CCK-8 assays examine the effect of DUSP6 on preadipocyte proliferation

Briefly, preadipocytes were seeded in 96-well plates and transfected with siRNA or NC at 60% cell density. Six hours later, the medium was changed to the complete medium. After incubation for 48 h, 10 μL of CCK reagent (Beyotime) was added to each well and incubated at 37°C and 5% CO₂ for 2 h. Then the absorbance at 450 nm were measured by the microplate reader.

Oil Red O staining and triglyceride determination

At the 7th day postinduction, the siRNA or NC treated mature adipocytes were stained using an Oil Red O kit (Solarbio) according to the manufacturer’s instructions, and morphologically viewed under a fluorescence microscope (Zeiss Axio Vert A1). To quantify the lipid droplets, cellular Oil Red O was extracted using 100% isopropanol and analyzed with optical absorbance at 510 nm.

For TG determination, the siRNA or NC treated mature adipocytes were collected at the 7th day postinduction and were lysed with 2% Trition. Cell TG content was determined using a Triglyceride kit (JianCheng) following the manufacturer’s procedure.

RNA extraction and reverse transcription quantitative polymerase chain reaction

Total RNA was extracted using TRIzol Reagent (Biomed), and was reversed into cDNA using the reverse transcription kit (Xinbei) after RNA integrity and RNA concentration analysis. RT-qPCR was performed using the SYBR Green PCR Master Mix (Xinbei) by using a CFX96 Touch Real-Time PCR Detection System (Bio-Rad). RT-qPCR primer information was listed in Table 2. Target gene expression levels were analyzed by the 2^−ΔΔCt method using GAPDH to normalize expression.

Statistical analysis

GraphPad Prism (Version 9; GraphPad Software) was used for statistical analysis. Statistical comparisons between two groups were made using the unpaired 2-tailed Student’s t test, multiple comparisons were performed using one-way ANOVA followed by Dunnett's or Tukey's multiple comparison test as recommended by GraphPad Prism. In all cases, levels of statistical significance were set at * p<0.05, ** p<0.01, and *** p<0.001. All data are presented as the mean±standard deviation. All experiments were performed (at least) in triplicate.

RESULTS

Validation of adipogenic differentiation ability of porcine subcutaneous preadipocytes

In order to identify the growth of primary cultured porcine subcutaneous preadipocytes and whether they can stably differentiate into mature adipocytes, we measured the growth curve, observed cell morphology and images of ORO staining, and also detected the expression trends of adipogenic marker genes during the differentiation. The growth curve showed an “S” shape (Figure 1A). Observation and analysis of cell morphology revealed that porcine preadipocytes had a homogeneous irregular spindle morphology when they were undifferentiated (Figure 1B). Successful differentiation was proved by positive ORO staining (Figure 1C), and significantly increases in the preadipocyte differentiation key genes expression, with the highest C/EBPβ level on day 2, and the highest PPARγ, FASN and FABP4 levels on day 6 (Figures 1D–1G). Therefore, we conclude that the cells had a high ability of adipogenic differentiation and can be used for subsequent functional studies.

Expression profile of DUSP6 in fat deposition related tissues and cells

To explore the expression characteristics of DUSP6, we first investigated DUSP6 expression levels in backfat and longissimus dorsi tissues from Youhulu type Huoshou Black pigs, a fat-type Chinese native pig breed and Landrace, a well-known commercial lean-type pig. We found that the expression of DUSP6 were dramatically higher in backfat and longissimus dorsi tissues from Youhulu type Huoshou Black pigs than in those from Landrace pigs (Figure 2A).

Next, we investigated DUSP6 expression levels every two days during adipocyte differentiation. In the adipocyte differentiation model, DUSP6 expression showed significant variation and reached the highest level on day 4 of adipogenic differentiation (Figure 2B), revealing a possible positive role of DUSP6 in porcine adipogenesis.

DUSP6 interference inhibits porcine subcutaneous preadipocyte proliferation

With the aim of elucidating the exactly functional roles of DUSP6 in porcine subcutaneous preadipocyte proliferation, three siRNAs specific for the porcine DUSP6 gene were designed and used to transfect porcine subcutaneous preadipocytes. The knockdown efficiency of three siRNAs was detected by RT-qPCR analysis at 48 h post-transfection in preadipocytes. The results indicated that si-DUSP6-857 had the strongest interference efficiency, with 79% and 78% compared to control and NC, respectively (Figure 3A), and this siRNA was selected as the best candidate siRNA for subsequent studies and was named as si-DUSP6.

The CCK-8 assay was used to analyze the proliferative effects of DUSP6 on porcine subcutaneous preadipocytes. Following DUSP6 knockdown, cell viability significantly decreased compared to the NC group after 48 h of treatment, indicating that DUSP6 knockdown inhibited adipocyte proliferation (Figure 3B). Coincidentally, the mRNA levels of important markers of cell proliferation like PCNA, CDK1, CDK2 were significantly downregulated due to the knockdown of DUSP6 in porcine subcutaneous preadipocytes (Figure 3C). Collectively, these data suggested that DUSP6 is required for porcine subcutaneous preadipocyte proliferation.

DUSP6 interference inhibits porcine subcutaneous preadipocyte differentiation

Then, to assess the effect of DUSP6 knockdown on adipocyte differentiation, porcine preadipocytes were transfected with si-DUSP6, and induced to differentiate. The expression of DUSP6 and the differentiation-related biomarkers in different periods of preadipocyte differentiation (days 0, 2,4, 6) were detected by RT-qPCR, and the TG content and lipid droplets were measured on day 7. As demonstrated, si-DUSP6 significantly decreased the expression of DUSP6 during adipocyte differentiation (Figure 4A). The levels of adipogenic marker genes PPARγ, C/EBPβ, FASN and FABP4 during adipocyte differentiation were significantly reduced at the mRNA level following knockdown of DUSP6, respectively (Figures 4B–4E). The results of Oil red O staining (Figure 4F), Oil Red O extraction (Figure 4G) and TG assay (Figure 4H) revealed that knockdown of DUSP6 significantly reduced the number of lipid droplets, the intracellular lipid content and TG accumulation in porcine adipocytes. Collectively, these data suggested that DUSP6 knockdown impaired the differentiation of porcine preadipocytes.

DISCUSSION

DUSP6 plays critical roles in development and disease, including an increasing connection to cancer progression [19,27,28]. Literature has also confirmed that DUSP6 is involved in white fat deposition in mice. Obesity in mice increased the DUSP6 (MKP-3) protein content in the hypothalamus, this hypothalamic upregulation led to an increase of food intake, adiposity, and body weight [29]. MKP-3 deficient mice are protected from several side effects of chronic Dex exposure, such as body weight gain, adipose tissue enlargement, hepatic lipid accumulation, and insulin resistance [30]. Mice lacking DUSP6/8 were resistant to high-fat diet-induced obesity [24]. The absence of MKP-3 also reduces adiposity in mice, possibly by repressing adipocyte differentiation [26]. However, the functional role of DUSP6 in white adipocyte adipogenesis in farm animals remains unknown. Here, we demonstrate for the first time that DUSP6 regulates the proliferation and differentiation of porcine subcutaneous preadipocytes. To the best of our knowledge, this is the first report on the role of porcine DUSP6 in fat formation. The results will facilitate our understanding of obesity in mammals and on the meat quality in domestic animals.

In this study, we first cultured subcutaneous primary preadipocytes from 3-day-old Huoshou black piglets as experimental materials, and then applied exogenous drugs DEX, IBMX, and insulin to induce preadipocytes differentiation. Here, in all tested in vitro cell samples, RT-qPCR results revealed that PPARγ, C/EBPβ, FASN and FABP4 expression were detected and upregulated in the differentiation process, implying that the differentiation model was applicable. Adipogenesis is a multi-step process, including the early (2 days after induction), intermediate (about the 3rd to 5th day after induction), and late stages (approximately after the fifth day of induction) of differentiation [31], which encompasses cascades of TFs for crucial proteins that induce gene expression to form mature adipocytes [32]. In mammalian white adipocytes, C/EBPβ, PPARγ are considered the key early regulators of adipogenesis, while FABP4 and FASN are responsible for the lipid formation in late stage of differentiation [33]. At the early stage of differentiation, there is a high expression of C/EBPβ and C/EBPδ in response to hormonal induction, resulting in the induction of PPARγ expression [34]. Upon activation, PPARγ induces the expression of many adipocyte genes, including C/EBPα, which is considered as a marker of mid stage differentiation [35,36]. The presence of C/EBPα may allow continued expression of PPARγ and perpetuation of the differentiated state [34]. The newly formed mature adipocytes still maintain a high expression of PPARγ and C/EBPα [36]. FASN, a key enzyme in the de novo synthesis of fatty acids, is involved in white adipocyte adipogenesis as a late adipogenic marker [33]. FABP4, also referred to as AP2, is expressed late during adipocyte differentiation and has been postulated to play important roles in fatty acid uptake and accumulation [37]. In our results of establishment of porcine subcutaneous preadipocyte differentiation model, the expression of early key differentiation related markers of C/EBPβ (significantly upregulated on the 2nd day and with the highest levels on day 2) and PPARγ (significantly upregulated on the 2nd day and remained at a relatively high level thereafter), and the expression of the lipogenic-related FABP4 (significantly upregulated during the 4th to 8th day of differentiation), FASN (significantly upregulated on the 2nd day and remained at a relatively high level thereafter) genes were almost consistent with their expression trends in previous white preadipocyte differentiation models. Besides, we also observed undifferentiated cell morphology and the lipid drops by Oil Red O staining assay, combined with results from the PPARγ, C/EBPβ, FASN and FABP4 RT-qPCR trial, indicating that the cultured preadipocytes had a highly homogeneous morphology and a high ability of adipogenic differentiation.

Gene expression is the basis for function. In the present study, our analyses demonstrated that the expression of DUSP6 were dramatically higher in backfat and longissimus dorsi tissues from Youhulu type Huoshou Black pigs (a fat-type Chinese native pig breed) than in those from Landrace pigs. These results are consistent with previous reports from mouse studies indicating that mice with diet-induced obesity has markedly increased DUSP6 expression levels in white adipose tissues [25,26,38]. Moreover, our results also revealed that DUSP6 expression levels were markedly different during the 2nd and 6th day of differentiation, with the sharpest increase on the 4th day, hypothesizing that DUSP6 may mainly be involved in mid stages of the porcine preadipocytes differentiation process. These data suggest a potential positive role of DUSP6 in the fat accumulation of pigs.

The proliferation and differentiation of preadipocytes were vital for fat tissue formation, and the rate and number of preadipocyte proliferation determined the degree of adipocytes development [39]. As our data showed, down-regulation of DUSP6 by siRNA resulted in a significant decrease of cell viability and the expression levels of cell cycle-related genes including PCNA, CDK1, CDK2, which are the key components of cell cycle signaling pathway and act as positive regulators in promoting cell cycle progression. PCNA, primarily synthesized during the S phase of the cell cycle, participates in DNA replication and regulates the cell cycle progression [40,41]. CDK1 binds to Cyclin B to form a complex, thereby acquiring kinase activity, which drives the G2/M transition [42]. CDK2 binds to Cyclin E and inactivates the retinoblastoma protein via phosphorylation, thereby initiating the G1/S transition [43]. This is a particularly encouraging result and indicates that DUSP6 positively regulates porcine preadipocyte proliferation through PCNA, CDK1 and CDK2. Similar observations regarding the influence of DUSP6 on cell proliferation have been documented. Targeted knockdown of DUSP6 by siRNA significantly inhibited the proliferation of human TPC1 thyroid cancer cells [44]. Knockdown DUSP6 with siRNA inhibited proliferation, migration, and invasion in gastric cancer cells [45]. Song et al [46] showed that down regulation of DUSP6 in MDA-MB-231 cells suppressed the cell proliferation, and meanwhile the cells were arrested at G0/G1 phase. This is the first report on the role of DUSP6 in regulating the growth rate of preadipocytes in farm animals, while, the cellular mechanisms underlying this effect are still need to be further study. These observations suggested the necessity for additional research on how siDUSP6 affected the cell cycle progression and the expressions of PCNA, CDK1 and CDK2 in the porcine subcutaneous preadipocyte proliferation process.

In the present study, we demonstrated for the first time that si-DUSP6, inhibits adipogenesis in porcine subcutaneous preadipocytes, potentially through hindering the expression of adipogenic marker genes (including PPARγ, C/EBPβ, FASN and FABP4). As our data showed, with the decrease in DUSP6 during adipocytes differentiation, PPARγ, C/EBPβ, FASN and FABP4 genes expression constantly decreased; consequently, the accumulation of the TG content and lipid droplets significantly reduced. This indicated that DUSP6 functions as a positive regulator in porcine subcutaneous preadipocyte differentiation and lipid accumulation. Our findings are consistent with the observations in 3T3-L1 cells and the stromal vascular cells isolated from gonadal adipose tissue of Dusp6−/− mice, with the white preadipocyte differentiation efficiency compromised by DUSP6 knockdown [26]. The mechanism by which DUSP6 regulates white adipocyte adipogenesis has not yet been extensively elucidated at the cellular level. However, it is currently understood that in gonadal and mesenteric fat tissues of MKP-3^−/− male mice fed an HFD, DUSP6-mediated regulation of adipogenesis operates independently of the ERK pathway [26]. Interestingly, a previous study revealed that DUSP6 inhibits brown adipocyte differentiation in mice via regulation of ERK phosphorylation [47]. It cannot be excluded that these discrepancies resulted from the different type of cells. In particular, DUSP6 expression was significantly downregulated during brown adipocyte differentiation compared with white adipogenesis [47]. This could be because gene regulation networks are very complicated. In cells, the expression of genes is regulated by multiple genes and signaling pathways. Therefore, we guessed that the different roles of DUSP6 in white and brown adipocyte adipogenesis could possibly be due to the complexity of cellular signaling regulatory networks.

Our study had several limitations. It needs to be pointed out that our experiments were performed only in vitro. Therefore, it remains to be investigated whether DUSP6 modulates white fat adipogenesis in pigs in vivo. Furthermore, the regulatory pathway mechanisms by which DUSP6 affects white adipocyte proliferation and differentiation requires more studies.

CONCLUSION

In conclusion, this is the first report on the regulatory role of DUSP6 gene in regulating the proliferation and differentiation of porcine subcutaneous preadipocytes. Together, our data demonstrate that DUSP6 is required for white adipocyte adipogenesis in pigs, thus warranting its consideration as an important regulator of porcine fat adipogenesis. Further exploration of the detailed mechanisms of DUSP6 in porcine adipogenesis should lead to the identification of additional targets for the selection of fat deposition traits in pigs and the prevention and treatment of obesity.

Notes

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

AUTHORS’ CONTRIBUTION

Conceptualization: Yang X, Yin Z, Ding Y.

Data curation: Yang X, Sun X, Du Z, Wang Q.

Formal analysis: Yi J, Yin D, Zhang Y.

Methodology: Ding X, Zheng X, Zhang X.

Software: Yang X, Sun X, Du Z.

Validation: Yang X, Yin Z, Ding Y.

Investigation: Yang X, Wang Q.

Writing - original draft: Yang X, Yin Z, Ding Y.

Writing - review & editing: Yang X, Sun X, Du Z, Yi J, Wang Q, Yin D, Zhang Y, Ding X, Zheng X, Zhang X, Yin Z, Ding Y.

FUNDING

This research was funded by the National Key Research and Development Program of China (2021YFD1301200), the Joint Research Project on Local Pig Breeding in Anhui Province (340000211260001000431), the National Natural Science Foundation of China (32573167), the Collaborative Innovation Project of Universities in Anhui Province (GXXT-2023-059), and the Anhui Provincial Modern Industrial Technology System of Swine (AHCYJSTX-05-03, AHCYJSTX-05-01).

ACKNOWLEDGMENTS

Not applicable.

SUPPLEMENTARY MATERIAL

Not applicable.

DATA AVAILABILITY

Upon reasonable request, the datasets of this study can be available from the corresponding author.

ETHICS APPROVAL

Our research was approved by the Anhui Agricultural University Animal Ethics Committee under permission No. KKLL2025014.

DECLARATION OF GENERATIVE AI

No AI tools were used in this article.

Figure 1

Validation of adipogenic differentiation ability of the porcine subcutaneous preadipocytes. (A) Growth curve of primary cultured porcine preadipocytes. (B) Cell morphology of undifferentiated preadipocytes, bar = 50 μm. (C) Oil red O staining of lipid droplets on the 8th day of differentiation, bar = 50 μm. (D–G) The relative expression levels of PPARγ, C/EBPβ, FASN and FABP4 in porcine preadipocytes after inducing differentiation on 0, 2nd, 4th, 6th, 8th day (Significance vs. 0 day, * p<0.05, ** p<0.01, and *** p<0.001).

Figure 2

Expression profile of DUSP6 in tissues and cells. (A) DUSP6 was highly expressed in backfat and longissimus dorsi tissues of fat-type pigs (Significance vs. Landrace, ** p<0.01, and *** p<0.001). (B) DUSP6 expression in porcine preadipocyte after inducing differentiation on 0, 2nd, 4th, 6th, 8th day (Significance vs. 0 day, *** p<0.001).

Figure 3

DUSP6 promotes porcine subcutaneous preadipocyte proliferation. (A) si-857 is the best interfering sequence for DUSP6 (Significance vs. Control/NC, ns, p>0.05; *** p<0.001). (B) The cell viability of preadipocyte after transfection for 48 h (Significance vs. NC, ** p<0.01). (C) RT-qPCR detection of mRNA levels of proliferation-related marker genes in adipocytes after transfection for 48 h (Significance vs. NC, * p<0.05, ** p<0.01, and *** p<0.001). NC, negative control; RT-qPCR, reverse transcription quantitative polymerase chain reaction.

Figure 4

Interference of DUSP6 inhibits preadipocyte differentiation. (A–E) DUSP6 and the adipogenic markers (PPARγ, C/EBPβ, FASN and FABP4) mRNA levels in adipocytes infected with si-DUSP6, NC on day 0 (D0), day 2 (D2), day 4 (D4) and day 6 (D6) after differentiation (Significance vs. NC, * p<0.05, ** p<0.01, and *** p<0.001). (F–H) Oil Red O staining (bar = 50 μm), Oil Red O relative absorbance, and triglyceride content in adipocytes infected with si-DUSP6, NC on the 7th day after differentiation (Significance vs. NC, ** p<0.01, and *** p<0.001). NC, negative control; TG, triglyceride.

Table 1

The sequence information of RNA oligo for interference of porcine DUSP6

Name	Upstream primer sequence	Downstream primer sequence
Si-DUSP6-1282	GGCCAUUUCUUUCAUAGAUTT	AUCUAUGAAAGAAAUGGCCTT
Si-DUSP6-1402	GUCGAUGAAUGAUGCUUAUTT	AUAAGCAUCAUUCAUCGACTT
Si-DUSP6-857	GAAGGUGGUUUCAGUAAGUTT	ACUUACUGAAACCACCUUCTT
Negative control	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT

Table 2

Primers information

Gene (GeneBank number)	Primer sequence (5′–3′)	Length (bp)	Annealing temperature (°C)
GAPDH (NM_001206359)	F: TGGAAAGGCCATCACCATCT R: ATGGTCGTGAAGACACCAGT	105	60
DUSP6 (NM_001267842)	F: AGTCTGACCTTGACCGAGAC R: CCCAAGTAGAGGAAGGGCAA	109	60
PPARγ (NM_214379)	F: TGGCCATTCGCATCTTTCAG R: ATCTCGTGGACGCCATACTT	145	60
C/EBPβ (NM_001199889)	F: CAGCCTTCGGAACAGTCAAG R: ATATGCAGCCGCTATGTCCT	198	60
FASN (NM_001099930)	F: ACTCCATCCCAGGAAAGTGG R: GAAGCAGCAGAACAGAGGTG	132	60
FABP4 (NM_001002817)	F: CCTTCAAATTGGGCCAGGAA R: GGTGGTTGTCTTTCCATCCC	122	60
PCNA (NM_001291925)	F: CTGAAGAAGGTGCTGGAAGC R: TGAGACGAGTCCATGCTCTG	98	60
CDK1 (NM_001159304)	F: TGGCCAGAAGTGGAGTCTTT R: CAGAAATTCGCTTGGCAGGA	151	60
CDK2 (NM_001285465)	F: TACACCCATGAGGTGGTGAC R: GTCCCGAGAGTCCGAAAGAT	188	60

REFERENCES

1. Lingvay I, Cohen RV, le Roux CW, Sumithran P. Obesity in adults. Lancet 2024;404:972–87. https://doi.org/10.1016/S0140-6736(24)01210-8

2. Zhang Y, Feng G, Zhang W, Liu X. Natural compounds exert anti-obesity effects by regulating cytokines. Phytother Res 2025;39:2824–47. https://doi.org/10.1002/ptr.8508

3. Chilamakuri SN, Manasa N, Thalla M, et al. Role of microneedles for improved treatment of obesity: progress and challenges. Mol Pharm 2025;22:2350–71. https://doi.org/10.1021/acs.Molpharmaceut.4c01115

4. Welsh A, Hammad M, Piña IL, Kulinski J. Obesity and cardiovascular health. Eur J Prev Cardiol 2024;31:1026–35. https://doi.org/10.1093/eurjpc/zwae025

5. Pahlavani M, Pham K, Kalupahana NS, et al. Thermogenic adipose tissues: promising therapeutic targets for metabolic diseases. J Nutr Biochem 2025;137:109832. https://doi.org/10.1016/j.jnutbio.2024.109832

6. Kazemi N, Ramazani E, Tayarani-Najaran Z. In vitro effects of phytochemicals on adipogenesis with a focus on molecular mechanisms: a systematic review. Iran J Basic Med Sci 2025;28:401–17. https://doi.org/10.22038/IJBMS.2025.78924.17090

7. Ma Y, Han L, Hou S, et al. Fatty acids and volatile flavor components of adipose tissue from local Tibetan sheep in Qinghai with dietary supplementation of Palm Kernel Meal (PKM). Animals 2024;14:2113. https://doi.org/10.3390/ani14142113

8. Zhang S, Huang Y, Zheng C, et al. Leucine improves the growth performance, carcass traits, and lipid nutritional quality of pork in Shaziling pigs. Meat Sci 2024;210:109435. https://doi.org/10.1016/j.meatsci.2024.109435

9. Liu S, Yang Y, Luo H, Pang W, Martin GB. Fat deposition and partitioning for meat production in cattle and sheep. Anim Nutr 2024;17:376–86. https://doi.org/10.1016/j.aninu.2024.03.003

10. Zhang J, Meng S, Wang H, et al. Comparison of growth performance, carcass properties, fatty acid profile, and genes involved in fat metabolism in Nanyang and Landrace pigs. Genes 2024;15:186. https://doi.org/10.3390/genes15020186

11. Schiavon S, Toscano A, Giannuzzi D, et al. Effects of slaughter weight and backfat depth on trimming, curing, and deboning losses and quality traits of Italian dry-cured ham. Food Res Int 2024;188:114450. https://doi.org/10.1016/j.foodres.2024.114450

12. Qi W, Zhu S, Feng L, et al. Integrated analysis of the transcriptome and microbial diversity in the intestine of miniature pig obesity model. Microorganisms 2024;12:369. https://doi.org/10.3390/microorganisms12020369

13. Choi YR, Kim YS, Kim MJ. Cinnamyl alcohol attenuates adipogenesis in 3T3-L1 cells by arresting the cell cycle. Int J Mol Sci 2024;25:693. https://doi.org/10.3390/ijms25020693

14. Lin ZZ, Li ZQ, Li JJ, et al. Mfsd2a promotes the proliferation, migration, differentiation and adipogenesis of chicken intramuscular preadipocytes. Braz J Poult Sci. 2022. 24:eRBCA2021-1547https://doi.org/10.1590/1806-9061-2021-1547

15. Zhang XH, Li JX, Wu XX, et al. PABPN1 functions as a downstream gene of CREB to inhibit the proliferation of preadipocytes. Anim Biosci 2025;38:41–53. https://doi.org/10.5713/ab.24.0072

16. Jia Z, Jin Z, Li M, et al. E2F transcription factor 5, a new regulator in adipogenesis to mediate the role of Krüppel-like factor 7 in chicken preadipocyte differentiation and proliferation. Poult Sci 2024;103:103728. https://doi.org/10.1016/j.psj.2024.103728

17. Yang M, Jiang J, Ren R, Gao N, He J, Zhang Y. Role of ADAR1 on proliferation and differentiation in porcine preadipocytes. Animals 2024;14:1201. https://doi.org/10.3390/ani14081201

18. Pan AL, Audrain M, Sakakibara E, et al. Dual-specificity protein phosphatase 6 (DUSP6) overexpression reduces amyloid load and improves memory deficits in male 5xFAD mice. Front Aging Neurosci 2024;16:1400447. https://doi.org/10.3389/fnagi.2024.1400447

19. Png CW, Weerasooriya M, Li H, et al. DUSP6 regulates Notch1 signalling in colorectal cancer. Nat Commun 2024;15:10087. https://doi.org/10.1038/s41467-024-54383-y

20. Jiang C, Saiki Y, Hirota S, et al. Ablation of dual-specificity phosphatase 6 protects against nonalcoholic fatty liver disease via cytochrome P450 4A and mitogen-activated protein kinase. Am J Pathol 2023;193:1988–2000. https://doi.org/10.1016/j.ajpath.2023.09.003

21. Ma Y, Liu Y, He S, Jiang Z. DUSP6: potential interactions with FXR1P in the nervous system. Indian J Biochem Biophys 2022;59:229–37.

22. Ahmad MK, Abdollah NA, Shafie NH, Yusof NM, Razak SRA. Dual-specificity phosphatase 6 (DUSP6): a review of its molecular characteristics and clinical relevance in cancer. Cancer Biol Med 2018;15:14–28. https://doi.org/10.20892/j.issn.2095-3941.2017.0107

23. Lin MC, Peng ZY, Chou HC, et al. Fecal protein analysis of Dusp6 knockout C57BL/6J mice by metaproteomics. Appl Biochem Biotechnol 2023;195:4215–36. https://doi.org/10.1007/s12010-023-04336-w

24. Liu R, Peters M, Urban N, Knowlton J, Napierala T, Gabrysiak J. Mice lacking DUSP6/8 have enhanced ERK1/2 activity and resistance to diet-induced obesity. Biochem Biophys Res Commun 2020;533:17–22. https://doi.org/10.1016/j.bbrc.2020.08.106

25. Xu H, Yang Q, Shen M, et al. Dual specificity MAPK phosphatase 3 activates PEPCK gene transcription and increases gluconeogenesis in rat hepatoma cells. J Biol Chem 2005;280:36013–8. https://doi.org/10.1074/jbc.M508027200

26. Feng B, Jiao P, Helou Y, et al. Mitogen-activated protein kinase phosphatase 3 (MKP-3)–deficient mice are resistant to diet-induced obesity. Diabetes 2014;63:2924–34. https://doi.org/10.2337/db14-0066

27. Laragione T, Harris C, Rice N, Gulko PS. DUSP6 deletion protects mice and reduces disease severity in autoimmune arthritis. iScience 2024;27:110158. https://doi.org/10.1016/j.isci.2024.110158

28. Jiang H, Deng L, Lin Z, et al. GSDMB interacts with IGF2BP1 to suppress colorectal cancer progression by modulating DUSP6-ERK pathway. Int Immunopharmacol 2024;143:113280. https://doi.org/10.1016/j.intimp.2024.113280

29. Rodrigues BA, Muñoz VR, Kuga GK, et al. Obesity increases mitogen-activated protein kinase phosphatase-3 levels in the hypothalamus of mice. Front Cell Neurosci 2017;11:313. https://doi.org/10.3389/fncel.2017.00313

30. Feng B, He Q, Xu H. FOXO1-dependent up-regulation of MAP kinase phosphatase 3 (MKP-3) mediates glucocorticoid-induced hepatic lipid accumulation in mice. Mol Cell Endocrinol 2014;393:46–55. https://doi.org/10.1016/j.mce.2014.06.001

31. Zhao Y, Pan J, Cao C, et al. RNF20 affects porcine adipocyte differentiation via regulation of mitotic clonal expansion. Cell Prolif 2021;54:e13131. https://doi.org/10.1111/cpr.13131

32. Lefterova MI, Lazar MA. New developments in adipogenesis. Trends Endocrinol Metab 2009;20:107–14. https://doi.org/10.1016/j.tem.2008.11.005

33. Moseti D, Regassa A, Kim WK. Molecular regulation of adipogenesis and potential anti-adipogenic bioactive molecules. Int J Mol Sci 2016;17:124. https://doi.org/10.3390/ijms17010124

34. Brun RP, Kim JB, Hu E, Altiok S, Spiegelman BM. Adipocyte differentiation: a transcriptional regulatory cascade. Curr Opin Cell Biol 1996;8:826–32. https://doi.org/10.1016/S0955-0674(96)80084-6

35. Tontonoz P, Spiegelman BM. Fat and beyond: the diverse biology of PPARγ. Annu Rev Biochem 2008;77:289–312. https://doi.org/10.1146/annurev.biochem.77.061307.091829

36. Wojciechowicz T, Kolodziejski PA, Billert M, Strowski MZ, Nowak KW, Skrzypski M. The effects of neuropeptide B on proliferation and differentiation of porcine white preadipocytes into mature adipocytes. Int J Mol Sci 2023;24:6096. https://doi.org/10.3390/ijms24076096

37. Mersmann HJ, Ding ST. Fatty acids modulate porcine adipocyte differentiation and transcripts for transcription factors and adipocyte-characteristic proteins. J Nutr Biochem 2001;12:101–8. https://doi.org/10.1016/S0955-2863(00)00136-4

38. Pfuhlmann K, Pfluger PT, Schriever SC, Müller TD, Tschöp MH, Stemmer K. Dual specificity phosphatase 6 deficiency is associated with impaired systemic glucose tolerance and reversible weight retardation in mice. PLOS ONE 2017;12:e0183488. https://doi.org/10.1371/journal.pone.0183488

39. Liu X, Qin K, Wang C, et al. Butyric acid reduced lipid deposition in immortalized chicken preadipocyte by inhibiting cell proliferation and differentiation. Poult Sci 2024;103:104171. https://doi.org/10.1016/j.psj.2024.104171

40. Bravo R, Frank R, Blundell PA, Macdonald-Bravo H. Cyclin/PCNA is the auxiliary protein of DNA polymerase-δ. Nature 1987;326:515–7. https://doi.org/10.1038/326515a0

41. Juríková M, Danihel Ľ, Polák Š, Varga I. Ki67, PCNA, and MCM proteins: markers of proliferation in the diagnosis of breast cancer. Acta Histochem 2016;118:544–52. https://doi.org/10.1016/j.acthis.2016.05.002

42. Krek W, Nigg EA. Differential phosphorylation of vertebrate p34cdc2 kinase at the G1/S and G2/M transitions of the cell cycle: identification of major phosphorylation sites. EMBO J 1991;10:305–16. https://doi.org/10.1002/j.1460-2075.1991.tb07951.x

43. Su TT, Stumpff J. Promiscuity rules? The dispensability of cyclin E and Cdk2. Sci Stke. 2004. 2004:pe11https://doi.org/10.1126/stke.2242004pe11

44. Gu Y, Li D, Luo Q, et al. MicroRNA-145 inhibits human papillary cancer TPC1 cell proliferation by targeting DUSP6. Int J Clin Exp Med 2015;8:8590–8.

45. Wu QN, Liao YF, Lu YX, et al. Pharmacological inhibition of DUSP6 suppresses gastric cancer growth and metastasis and overcomes cisplatin resistance. Cancer Lett 2018;412:243–55. https://doi.org/10.1016/j.canlet.2017.10.007

46. Song H, Wu C, Wei C, et al. Silencing of DUSP6 gene by RNAi-mediation inhibits proliferation and growth in MDA-MB-231 breast cancer cells: an in vitro study. Int J Clin Exp Med 2015;8:10481–90.

47. Kim WK, Oh KJ, Choi HR, et al. MAP kinase phosphatase 3 inhibits brown adipocyte differentiation via regulation of Erk phosphorylation. Mol Cell Endocrinol 2015;416:70–6. https://doi.org/10.1016/j.mce.2015.08.023