Microsatellite analysis revealed the genetic diversity and population structure of 18 native black goat breeds in China

Article information

Anim Biosci. 2026;39.250224
Publication date (electronic) : 2025 June 24
doi : https://doi.org/10.5713/ab.25.0224
1Southwest University, Chongqing, China
2College of Animal Science and Technology, Southwest University, Chongqing Engineering Research Centre for Herbivores Resource Protection and Utilization, Chongqing Key Laboratory of Forage & Herbivore, Chongqing, China
3Chongqing Tengda Animal Husbandry Co., Ltd., Chongqing, China
*Corresponding Author: Yanguo Han, Tel: +86-23-68251196, E-mail: hyg2015@swu.edu.cn
aThese authors contributed equally to this work.
Received 2025 April 3; Revised 2025 May 8; Accepted 2025 June 17.

Abstract

Objective

In China and Southeast Asia, black goats command higher selling prices. However, the blind breeding practices carried out by farmers pose a threat to the original genetic diversity of the population. Therefore, the objective of this study is to conduct a systematic detection of the genetic diversity of native black goat breeds, aiming to provide a reference for the protection and improvement of these valuable native black goat breeds.

Methods

Genetic diversity and population structure of 18 black goat breeds were estimated by utilizing 16 microsatellite markers. Subsequently, data analysis was carried out with the assistance of software like Phylip, Fstat, Arlequin, Structure. For the purpose of visualization, ITOL and Structure Selector were used to present the results in a visual manner.

Results

The mean number of alleles per population ranged from 4.75 to 9.56, with an average of 6.38. The observed heterozygosity of each breed ranged from 0.46 to 0.68, all of which were lower than the expected heterozygosity. The inbreeding coefficient (FIS) of the 18 breeds ranged from −0.003 to 0.376. Among them, the FIS values of Meigu goat (MG), Yimeng black goat, Yunling goat, Guizhou black goat and Ziwuling black goat were significantly higher than those under random rearrangement (p<0.05). All pairwise Fixation index between the Chinese black goat populations reached a significant level (p<0.05). Finally, the results of Bayesian model-based clustering and a neighbor-joining tree based on Nei’s genetic distance showed these eighteen breeds can be further classified into seven genetic clusters.

Conclusion

All breeds showed high genetic diversity. MG had excessive inbreeding, and CZ and LZ were at risk of losing original genetic traits. Similar geographical and climatic conditions might lead to similar genetic materials in different breeds.

INTRODUCTION

In recent years, chevon, boasting its attributes of high protein and low fat, along with an abundance of unsaturated fatty acids (linoleic acid and linolenic acid), is becoming increasingly popular among people, and its production has been increasing year by year [1]. As a livestock breed with extremely strong adaptability, goats are widely distributed around the world, especially in Asia and Africa [2]. In East Asia and Southeast Asia, due to the influence of traditional customs, local communities show a distinct preference for black. Correspondingly, black goats are more popular and command higher prices [3, 4]. China has a rich diversity of black goat breeds. According to the statistics of the Chinese National Germplasm Center of Domestic Animals, there are approximately 45 breeds [5]. In order to obtain higher profits, farmers raising black goats will also carry out certain breeding and hybridization programs. However, due to the lack of scientific guidance, these programs are often carried out blindly in many cases. To date, no systematic research has been conducted to analyze black goat breeds genetic diversity and population structure.

Microsatellite markers have been widely used as a method for assessing genetic diversity in the evaluation of the genetic diversity of goats. For example, dairy goats [6, 7], cashmere goats [8, 9] and meat goats [10]. In addition, some researchers have utilized microsatellite markers to study the population structure and phylogenetic relationships of goats in different regions [1113]. In this study, 16 microsatellite markers were used to evaluate the genetic diversity and population structure of 18 black goat breeds in China. The study was expected to provide the scientific conservation and breeding plans for native black goat breeds.

MATERIALS AND METHODS

Experimental animals and DNA extraction

A total of 661 black goats from eighteen breeds/types spanning the entire distribution range of Chinese black goats were analysed. Samples for each breed were obtained from conservation farms in their native regions. From the population of healthy adult goats with breed-typical characteristics across different pedigrees, 10% were randomly selected as experimental subjects. All experimental procedures were approved by the Animal Care and Use Committee of Southwest University (No. IACUC-20240920-07). The specific number of samples for each breed and their geographical locations are shown in Table 1. Samples were obtained by collecting blood from the jugular vein. The genomic DNA was extracted following the standard phenol: chloroform protocol [14]. The quality of the DNA was evaluated by means of a 0.8% agarose gel, and the extracted DNA was quantified using a DTX microplate reader (Beckman Coulter).

Sampling information of 18 black goat breeds

Polymerase chain reaction amplification and sequencing

All goats were genotyped using 16 microsatellite markers (Table 2) recommended by the Food and Agriculture Organization of the United Nations [15]. The 10 μL polymerase chain reaction (PCR) reaction system includes 2×Taq PCR Master Mix, 5μL; template DNA, 1μL; primer F and primer R (10 pmol/μL), each is 0.5μL; ddH2O, 3 μL. The reaction program is as follows: pre-denaturation 95°C for 5 min; denaturation 95°C for 30 s, annealing at 55°C or 58°C (the annealing temperatures vary for different primers.) for 30 s, 72°C extension for 30 s, 10 cycles (annealing temperature reduced 1°C per cycle); denaturation 95°C for 30 s, 52°C annealing for 30 s, 72°C extension for 30 s, 25 cycles; extension at 72°C for 20 min. Sequencing was carried out using the ABI 3730xl (Applied Bio Systems). After the raw data in the .fsa format were exported from the ABI 3730xl, they were imported into the Gene Marker (Promega) analysis software to obtain the original genotypic data.

Primer information of sixteen microsatellites

Statistical analysis

The original data were analyzed using the Microsatellites toolkit [16] to obtain the number of alleles (NA), the mean number of alleles (MNA), the effective number of alleles (NEA), the number of private alleles (NPA), the expected heterozygosity (HE), the observed heterozygosity (HO), and the polymorphic information content (PIC). The allelic richness (AR) of each population was calculated using the Fstat v1.2. [17] Arlequin 3.5. [18] was used to calculate whether the microsatellite loci deviated from the Hardy-Weinberg equilibrium (HWE), the genetic differentiation index (FST), and the inbreeding coefficient (FIS). The Phylip software package [19] was utilized to construct a Neighbor-Joining (NJ) tree based on the DA genetic distance. Subsequently, the resulting tree was visualized using the online software Itol [20]. To infer the genetic structure of the breeds, the software Structure v2.3.4. [21] was applied with a Bayesian clustering approach 15. Finally, the optimal K value was determined using the online software Structure Selector [22], and a corresponding clustering diagram was generated to illustrate the genetic relationships among the breeds.

RESULTS

The polymorphism of microsatellite loci

At the 16 selected loci, the average NA was 20.5 (Table 3). Among them, the loci SRCRSP23 and TCRVB6 had the largest NA, which was 30, while there were only 7 alleles at the MAF209 locus, which was the least among the 16 loci. The average NEA at the loci was 3.30 (ranging from 1.62 [MAF209] to 4.96 [SRCRSP8]). The average HO and HE were 0.59 and 0.63 respectively (ranging from 0.22 [SRCRSP7] to 0.74 [SRCRSP8] for HO and from 0.36 [MAF209] to 0.80 [SRCRSP8] for HE), and the average PIC was 0.59 (ranging from 0.29 [MAF209] to 0.76 [SRCRSP8]). Except for a few loci, the PIC of the remaining loci was higher than 0.5.

Estimated values of genetic diversity indices at 16 loci for 18 black goat breeds

The genetic diversity of the breeds

By using 16 microsatellite markers to evaluate the genetic diversity of black goats from different breeds, we found that MG had the largest total NA, which was 153, while JC had the least NA (76) (Table 4). Correspondingly, MG had the highest MNA and AR, which were 9.56 (4.19) and 7.26 (2.45) respectively; JC had the lowest MNA and AR, which were 4.75 (1.53) and 4.02 (1.17) respectively. However, in terms of the indicator of the NEA at the loci, LW had the highest average NEA, which was 4.18 (1.70), while FQ had the lowest average NEA (2.65 [0.90]). The total NA of these two were neither the highest nor the lowest. In this study, the range of the HO of each population was 0.46 to 0.68, and the range of the HE was 0.59 to 0.74. The HO of all populations was lower than the HE. Thirteen loci in MG deviated from the HWE. There were no loci deviating from the HWE in DZ and BY. The average number of loci deviating from the HWE for all breeds was 3.39.

Diversity parameters in 18 Chinese black goat breeds

Intra-population inbreeding and inter-population genetic differentiation

In order to evaluate the degree of inbreeding within populations and the genetic differentiation between populations, F-statistics were calculated. The FIS values of the 18 populations ranged from −0.003 to 0.376, showing a relatively large span. Among them, the FIS values of MG, YM, YL, GZ, and ZWL were significantly higher than those under random rearrangement (p<0.05). The calculated values of FST are shown in Table 5 and Figure 1 and their significance is corrected using the Bonferroni method [23]. According to the definition by Sewall Wright [24], FST is classified into four levels: low (FST<0.05), moderate (0.05<FST<0.15), high (0.15<FST<0.25), and extremely high (FST>0.25). As shown in Figure 1, The FST values of YL, FQ, YM, LW, CD and MG were greater than 0.15 or 0.25 when compared with those of other breeds. This indicated that there was a high or extremely high level of genetic differentiation between them and other breeds.

Pairwise differences in population averages (Slatkins linearized FST) using microsatellite markers

Figure 1

Population average pairwise differences of 18 Chinese black goat breeds. ZWL, Ziwuling; GZ, Guizhou; XD, Xiangdong; MC, Macheng; LL, Lvliang; LZ, Leizhou; YL, Yunling; FQ, Fengqing; YM, Yimeng; LW, Laiwu; CD, Chengde; MG, Meigu; JC, Jianchang; BY, Baiyu; YD, Yudong; CZ, Chuanzhong; CN, Chuannan; DZ, Dazu. (These are all breed names of Chinese native black goats.)

Phylogenetic relationship and population structure of 18 populations

The clustering diagram can be used to analyze the population structure and estimate the number of subgroups within the population. According to Figure 2 A, when K = 7, the value of ΔK [25] was the largest, indicating that the optimal number of subgroups was 7. Figure 2 B was a phylogenetic tree of 18 populations. According to Figure 2 C, the clustering could be carried out as shown in the figure. JC and GZ were classified into one cluster; DZ, CN, YD, MC and CZ were classified into one cluster; BY, ZWL and LL were classified into one cluster; YM, CD, LW, YL and FQ were classified into one cluster; in addition, XD, LZ and MG were respectively classified into one cluster. Figure 2 C was a structural clustering diagram of 18 goat populations under the division of 6, 7 and 8 subgroups. It was known that the division into 7 subgroups was the optimal grouping method. Different colors on the clustering diagram indicated belonging to different subgroups. From the colors, it could be seen that in addition to the main color (the color with the largest proportion in the clustering diagram of a specific breed, such as the green color for DZ in Figure 2 C), there were more or less several other colors (in the clustering diagram of a specific breed, minor color components are observed, such as the red, purple, and yellow hues for DZ in Figure 2 C) among the 18 populations, indicating that there were hybridization situations with other breeds.

Figure 2

Phylogenetic tree and population structure clustering diagram of 18 black goat breeds. (A) Diagram of \Delta K values exported by Structure Selector. (B) Phylogenetic tree diagram of 18 goat breeds. (C) Clustering diagrams at K values of 6, 7, and 8. LL, Lvliang; ZWL, Ziwuling; BY, Baiyu; DZ, Dazu; CN, Chuannan; CZ, Chuanzhong; YD, Yudong; MC, Macheng; GZ, Guizhou; JC, Jianchang; XD, Xiangdong; LZ, Leizhou; CD, Chengde; LW, Laiwu; YM, Yimeng; FQ, Fengqing; YL, Yunling; MG, Meigu. (These are all breed names of Chinese native black goats.)

DISCUSSION

In this study, we evaluated the genetic diversity and population structure of 18 native black goat breeds in China using 16 microsatellite loci. The results showed that the NA, heterozygosity, and PIC of the 16 loci all exhibited relatively high levels. This indicated that the selected loci can effectively assess the diversity of the populations. The genetic variability quantified for each goat population is presented in Table 4. Vellnow et al [26] pointed out that the closer the NA was to the NEA, the more evenly the alleles were distributed within the breed. In this study, there were differences between the NEA and the NA for all breeds, which might be caused by artificial breeding [11]. Kreling et al [27] pointed out that the higher the breed-specific polymorphism of a breed, the lower gene exchange there was between it and other breeds. The MG breed had the highest NPA. Combining with the research of Kreling et al, it showed that the MG breed had less gene exchange with other breeds. In the study of Wei et al [28] on the genetic structure of native Chinese goat breeds, the genetic diversity of some of the goat breeds in this study (YL, JC, LZ, YM, LL, XD, FQ) was evaluated. The HO of YL (0.55), JC (0.57), LZ (0.53), YM (0.56), LL (0.65), and XD (0.55) were highly similar to the study by Wei et al. Nevertheless, there was a significant deviation between the HO of FQ in this study (0.57) and that in Wei’s study (0.52). Apart from the sampling error, it might also be related to introduction (introduction of new goat breeds) and cross – breeding [29]. Compared with relevant studies on goats in Europe and the Middle East [30], the average HO (0.59) and HE (0.63) of Chinese goats in this study were both lower than those of European goats (HO = 0.62, HE = 0.69). This suggested that the degree of genetic variation in Chinese goats was lower than that in European goat breeds, which was consistent with the results of previous studies on the genetic diversity of Chinese goats [28]. The breed with the most HWE was MG, with 13 loci showing such deviations. In this study, there were deviations between HO and HE in all breeds, indicating that all breeds had been disturbed to a certain extent. Deviations from HWE can arise in two situations. One is when individual populations are substructured into isolated smaller flocks within them, and the other is when populations are improperly managed by humans as a result of inbreeding [12, 31].

Inbreeding can increase the level of homozygosity within a population, thereby reducing genetic diversity [32]. The FIS values of MG, YM, YL, GZ, and ZWL were significantly higher than those under random rearrangement (p<0.05), indicating that inbreeding occurred in these breeds. It was notable that the FIS of the MG breed is 0.376, and it showed an extremely significant difference from the FIS under random rearrangement (p<0.001), indicating that the level of inbreeding in this breed was extremely high. The fact that its HO was 0.46, which was significantly lower than the HE of 0.74, also supports this conclusion. The FST was the indicator for evaluating the degree of population differentiation. YL, FQ, YM, LW, CD, and MG exhibited distinct genetic differentiation from other breeds. Among them, YM and LW were from East China, while CD was from North China. The substantial genetic divergence between these breeds and those from Southwest China could be largely attributed to geographical isolation. Interestingly, despite YL, FQ, and MG also being from Southwest China, they exhibited notable genetic differentiation from other local breeds (Table 1). This phenomenon might have been linked to the unique topographical features of their habitats or the extent of their genetic exchange with external populations [33]. Moreover, the p-values for all interspecific FST were below the corrected p-values, all demonstrating statistical significance. This finding strongly suggested that each breed had undergone distinct genetic evolution and functions as an independent breeding unit.

The neighbor - joining tree constructed using Reynolds distance for 18 native goat breeds showed that most breeds cluster according to their geographical locations. In the studies conducted by Di et al [8], Liu et al [9], and Wei et al [28], the goat populations they investigated were also mainly clustered based on geography. YL and FQ, located on the Yunnan - Guizhou Plateau at around 25°N latitude, were grouped together. JC and GZ, also on the Yunnan - Guizhou Plateau but at 27°N latitude, form another cluster. DZ, CN, YD, and CZ from the Sichuan Basin, along with MC from the eastern Hubei Plain, were classified as one cluster. Besides being at similar latitudes and on similar terrains, they were all located along the Yangtze River. Rivers have always been closely related to cultural exchanges, which in turn promote the exchange of genetic materials among organisms [34]. Over time, their genetic materials had become relatively stable. However, the Bayesian clustering diagram in Figure 2 C showed that the bar charts of goat breeds along the Yangtze River (DZ, CN, CZ, YD, MC) contained multiple colors (in addition to the main color, green, there are also mixtures of red, blue, yellow and pink.), indicating that the exchange of genetic materials among these breeds had not ceased. These results were consistent with E et al [12] XD and LZ in the coastal area also had bar charts with diverse colors (in addition to the predominant red or blue colors, other colors also constitute a significant proportion), which was evidence of their genetic material exchanged with other breeds. In contrast, except for a few individuals, the bar chart of MG showed a very single color, indicating that MG had a relatively pure bloodline with little external interference. This was consistent with the high - level inbreeding of MG mentioned earlier.

Notably, according to the phylogenetic tree and clustering diagram, YL and FQ from Yunnan had been grouped with YM and LW from Shandong and CD from Hebei, despite the large geographical distances between them. YM, LW, and CD live in mountainous areas at an average altitude of about 400 meters under a temperate monsoon climate, while FQ and YL are in plateau areas at an altitude of about 2,000 meters under a subtropical plateau monsoon climate. We speculate that the similar climate factors such as temperature and humidity in these areas (considering that the temperature drops by 6°C for every 1,000 meters increase in altitude) may have led to similar genetic materials after long - term natural selection [35]. It is also possible that the introduction of Boer goats for the improvement of native breeds has contributed to this similarity [36].

CONCLUSION

In our study, all 18 selected black goat breeds exhibited relatively high genetic diversity. However, MG is at risk of inbreeding depression. Additionally, we found that CZ and LZ had a high degree of cross - breeding through introduction, which to some extent masked their original genetic characteristics. Finally, we discovered that breeds from habitats with similar geographical and climatic conditions might possess relatively similar genetic materials. The main contribution of this study is a substantial analysis of the genetic diversity and genetic structure of native Chinese black goat breeds, providing a reference for the conservation and genetic improvement of these native breeds.

Notes

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

AUTHORS’ CONTRIBUTION

Conceptualization: Qin G, E G.

Data curation: E G, Huang D, Zeng Y.

Formal analysis: Zhang T, Jiaxue Guo J.

Writing - original draft: Zhang T, Guo J.

Writing - review & editing: Zhang T, Guo J, Qin G, E G, Huang D, Zeng Y, Zhao Y, Zhao Z, Huang Y, Han Y.

FUNDING

The research was supported by the Chongqing Science and Technology Innovation Key Project of China (No. CSTB 2022TIAD-CUX0013), the Strategic Collaboration Funds of Chongqing Municipal People’s Government-Chinese Academy of Agricultural Sciences, and Fundamental Research Project for the China Central Universities (SWU-XDJH 202301).

ACKNOWLEDGMENTS

We wish to express our appreciation to all those who provided assistance in sampling and data analysis.

SUPPLEMENTARY MATERIAL

Not applicable.

DATA AVAILABILITY

Upon reasonable request, the datasets of this study can be available from the corresponding author.

ETHICS APPROVAL

All experimental procedures were approved by the Animal Care and Use Committee of Southwest University (No. IACUC- 20240920-07).

DECLARATION OF GENERATIVE AI

No AI tools were used in this article.

References

1. Álvarez-Rodríguez J, Urrutia O, Lobón S, Ripoll G, Bertolín JR, Joy M. Insights into the role of major bioactive dietary nutrients in lamb meat quality: a review. J Anim Sci Biotechnol 2022; 13 :20. https://doi.org/10.1186/s40104-021-00665-0.
2. Amills M, Capote J, Tosser-Klopp G. Goat domestication and breeding: a jigsaw of historical, biological and molecular data with missing pieces. Anim Genet 2017; 48 :631 –44. https://doi.org/10.1111/age.12598.
3. Lai FY, Yin CY, Ding ST, Tu PA, Wang PH. Analysis of the population genetic structure using microsatellite markers in goat populations in Taiwan. Anim Biotechnol 2023; 34 :3294 –305. https://doi.org/10.1080/10495398.2022.2138414.
4. Sun X, Guo J, Li L, et al. Genetic diversity and selection signatures in Jianchang black goats revealed by whole-genome sequencing data. Animals 2022; 12 :2365. https://doi.org/10.3390/ani12182365.
5. National Germplasm Center of Domestic Animal Resources. Records of livestock breeds in China (sheep) [Internet] National Germplasm Center of Domestic Animal Resources; c2025. [cited 2025 Mar 18]. Available from: https://www.cdad-is.org.cn/admin/Zylist/index?type=sheep.
6. Wang GZ, Chen SS, Chao TL, et al. Analysis of genetic diversity of Chinese dairy goats via microsatellite markers. J Anim Sci 2017; 95 :2304 –13. https://doi.org/10.2527/jas.2016.1029.
7. Seilsuth S, Seo JH, Kong HS, Jeon GJ. Microsatellite analysis of the genetic diversity and population structure in dairy goats in Thailand. Asian-Australas J Anim Sci 2016; 29 :327 –32. https://doi.org/10.5713/ajas.15.0270.
8. Di R, Vahidi SMF, Ma YH, et al. Microsatellite analysis revealed genetic diversity and population structure among Chinese cashmere goats. Anim Genet 2011; 42 :428 –31. https://doi.org/10.1111/j.1365-2052.2010.02072.x.
9. Liu JB, Wang F, Lang X, et al. Analysis of geographic and pairwise distances among Chinese cashmere goat populations. Asian-Australas J Anim Sci 2013; 26 :323 –33. https://doi.org/10.5713/ajas.2012.12500.
10. Ling YH, Zhang XD, Yao N, et al. Genetic differentiation of Chinese indigenous meat goats ascertained using microsatellite information. Asian-Australas J Anim Sci 2012; 25 :177 –82. https://doi.org/10.5713/ajas.2011.11308.
11. Zhao P, Zhang L, Liu Y, et al. Genetic diversity and phylogenetic relationship estimation of Shanxi indigenous goat breeds using microsatellite markers. Anim Biotechnol 2023; 35 :2276717. https://doi.org/10.1080/10495398.2023.2276717.
12. E GX, Zhao YJ, Chen LP, et al. Genetic diversity of the Chinese goat in the littoral zone of the Yangtze River as assessed by microsatellite and mtDNA. Ecol Evol 2018; 8 :5111 –23. https://doi.org/10.1002/ece3.4100.
13. Nomura K, Ishii K, Dadi H, et al. Microsatellite DNA markers indicate three genetic lineages in East Asian indigenous goat populations. Anim Genet 2012; 43 :760 –7. https://doi.org/10.1111/j.1365-2052.2012.02334.x.
14. Sambrook J, Russell DW. Molecular cloning: a laboratory manual 3rd edth ed. Cold Spring Harbor Laboratory Press; 2001.
15. Food and Agriculture Organization of the United Nations (FAO). Guideline for molecular genetic characterization of animal genetic resources [Internet] FAO; c2025. [cited 2025 Mar 26]. Available from: https://www.fao.org/3/i2413e/i2413e00.htm.
16. Park SDE. Trypanotolerance in West African Cattle and the population genetic effects of selection [dissertation] University of Dublin; 2001.
17. Goudet J. FSTAT (version 1.2): a computer program to calculate F-statistics. J Hered 1995; 86 :485 –6. https://doi.org/10.1093/oxfordjournals.jhered.a111627.
18. Excoffier L, Lischer HEL. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour 2010; 10 :564 –7. https://doi.org/10.1111/j.1755-0998.2010.02847.x.
19. Abdennadher N, Boesch R. Porting PHYLIP phylogenetic package on the desktop GRID platform XtremWeb-CH. Stud Health Technol Inform 2007; 126 :55 –64.
20. iTOL. Interactive tree of life (iTOL) [Internet] Itol Team; c2024. [cited 2025 Mar 26]. Available from: https://itol.embl.de/.
21. Pritchard JK, Stephens M, Donnelly P. Inference of population structure using multilocus genotype data. Genetics 2000; 155 :945 –59. https://doi.org/10.1093/genetics/155.2.945.
22. Li YL, Liu JX. StructureSelector: a web-based software to select and visualize the optimal number of clusters using multiple methods. Mol Ecol Resour 2017; 18 :176 –7. https://doi.org/10.1111/1755-0998.12719.
23. Curtin F, Schulz P. Multiple correlations and Bonferroni’s correction. Biol Psychiatry 1998; 44 :775 –7. https://doi.org/10.1016/s0006-3223(98)00043-2.
24. Wright S. The genetical structure of populations. Ann Eugen 1949; 15 :323 –54. https://doi.org/10.1111/j.1469-1809.1949.tb02451.x.
25. Evanno G, Regnaut S, Goudet J. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol Ecol 2005; 14 :2611 –20. https://doi.org/10.1111/j.1365-294X.2005.02553.x.
26. Vellnow N, Gossmann TI, Waxman D. The pseudoentropy of allele frequency trajectories, the persistence of variation, and the effective population size. BioSystems 2024; 238 :105176. https://doi.org/10.1016/j.biosystems.2024.105176.
27. Kreling SES, Reese EM, Cavalluzzi OM, et al. City divided: unveiling family ties and genetic structuring of coyotes in Seattle. Mol Ecol 2024; 33 :e17427. https://doi.org/10.1111/mec.17427.
28. Wei C, Lu J, Xu L, et al. Genetic structure of Chinese indigenous goats and the special geographical structure in the Southwest China as a geographic barrier driving the fragmentation of a large population. PLOS ONE 2014; 9 :e94435. https://doi.org/10.1371/journal.pone.0094435.
29. Cardoso TF, Luigi-Sierra MG, Castelló A, et al. Assessing the levels of intraspecific admixture and interspecific hybridization in Iberian wild goats (Capra pyrenaica). Evol Appl 2021; 14 :2618 –34. https://doi.org/10.1111/eva.13299.
30. Cañón J, García D, García-Atance MA, et al. Geographical partitioning of goat diversity in Europe and the Middle East. Anim Genet 2006; 37 :327 –34. https://doi.org/10.1111/j.1365-2052.2006.01461.x.
31. Granevitze Z, Hillel J, Chen GH, et al. Genetic diversity within chicken populations from different continents and management histories. Anim Genet 2007; 38 :576 –83. https://doi.org/10.1111/j.1365-2052.2007.01650.x.
32. Onogi A, Shirai K, Amano T. Investigation of genetic diversity and inbreeding in a Japanese native horse breed for suggestions on its conservation. J Anim Sci 2017; 88 :1902 –10. https://doi.org/10.1111/asj.12867.
33. Whannou HRV, Spanoghe M, Dayo GK, Demblon D, Lanterbecq D, Dossa LH. Genetic diversity assessment of the indigenous goat population of Benin using microsatellite markers. Front Genet 2023; 14 :1079048. https://doi.org/10.3389/fgene.2023.1079048.
34. Ma H, Wang S, Zeng G, et al. The origin of a coastal indigenous horse breed in China revealed by genome-wide SNP data. Genes 2019; 10 :241. https://doi.org/10.3390/genes10030241.
35. Buckley LB, Miller EF, Kingsolver JG. Ectotherm thermal stress and specialization across altitude and latitude. Integr Comp Biol 2013; 53 :571 –81. https://doi.org/10.1093/icb/ict026.
36. Wang X, Li G, Jiang Y, Tang J, Fan Y, Ren J. Genomic insights into the conservation and population genetics of two Chinese native goat breeds. J Anim Sci 2022. 100 skac274. https://doi.org/10.1093/jas/skac274.

Article information Continued

Figure 1

Population average pairwise differences of 18 Chinese black goat breeds. ZWL, Ziwuling; GZ, Guizhou; XD, Xiangdong; MC, Macheng; LL, Lvliang; LZ, Leizhou; YL, Yunling; FQ, Fengqing; YM, Yimeng; LW, Laiwu; CD, Chengde; MG, Meigu; JC, Jianchang; BY, Baiyu; YD, Yudong; CZ, Chuanzhong; CN, Chuannan; DZ, Dazu. (These are all breed names of Chinese native black goats.)

Figure 2

Phylogenetic tree and population structure clustering diagram of 18 black goat breeds. (A) Diagram of \Delta K values exported by Structure Selector. (B) Phylogenetic tree diagram of 18 goat breeds. (C) Clustering diagrams at K values of 6, 7, and 8. LL, Lvliang; ZWL, Ziwuling; BY, Baiyu; DZ, Dazu; CN, Chuannan; CZ, Chuanzhong; YD, Yudong; MC, Macheng; GZ, Guizhou; JC, Jianchang; XD, Xiangdong; LZ, Leizhou; CD, Chengde; LW, Laiwu; YM, Yimeng; FQ, Fengqing; YL, Yunling; MG, Meigu. (These are all breed names of Chinese native black goats.)

Table 1

Sampling information of 18 black goat breeds

Breed Breed code Sample size North latitude East longitude Geographical location Region
Dazu black goat DZ 44 29°42′24.48″ 105°43′19.20″ Dazu, Chongqing, China Southwest China
Chuannan black goat CN 39 28°43′26.04″ 105°4′1.20″ Yibin, Sichuan, China Southwest China
Chuanzhong black goat CZ 68 30°14′28.66″ 105°3′12.63″ Lezhi, Sichuan, China Southwest China
Yudong black goat YD 29 29°19′32.52″ 107°45′36.00″ Wulong, Chongqing, China Southwest China
Baiyu black goat BY 20 31°12′34.56″ 98°49′28.20″ Baiyu, Sichuan, China Southwest China
Jianchang black goat JC 44 26°39′17.64″ 102°14′42.00″ Huili, Sichuan, China Southwest China
Meigu goat MG 33 28°19′22.29″ 103°7′57.50″ Meigu, Sichuan, China Southwest China
Chengde wujiao goat CD 35 41°25′3.34″ 117°34′47.55″ Chengde, Hebei, China North China
Laiwu black goat LW 31 36°12′11.52″ 117°39′36.00″ Laiwu, Shandong, China East China
Yimeng black goat YM 36 36°11′5.64″ 118°10′15.60″ Yiyuan, Shandong, China East China
Fengqing wujiao black goat FQ 24 24°34′49.80″ 99°55′42.60″ Fengqing, Yunnan, China Southwest China
Yunling goat YL 35 25°1′58.08″ 101°32′45.60″ Chuxiong, Yunnan, China Southwest China
Leizhou goat LZ 37 20°54′51.12″ 110°5′45.60″ Leizhou, Guangdong, China South China
Lvliang biack goat LL 40 37°31′6.24″ 111°8′38.40″ Lvliang, Shanxi, China North China
Macheng biack goat MC 36 31°10′16.68″ 115°0′36.00″ Macheng, Hubei, China Central China
Xiangdong biack goat XD 32 28°12′25.01″ 113°43′9.52″ Liuyang, Hunan, China Central China
Guizhou black goat GZ 40 27°4′11.21″ 105°9′41.62″ Bijie, Guizhou, China Southwest China
Ziwuling black goat ZWL 38 36°12′21.24″ 107°32′15.06″ Qingyang, Gansu, China Northwest China

Table 2

Primer information of sixteen microsatellites

Locus Chromosomal location Sequence (5′–3′) (bp) Fragment length (bp) Melting temperature (°C)
CSRD247 F OAR14 GGACTTGCCAGAACTCTGCAAT 220–247 58
CSRD247 R OAR14 CACTGTGGTTTGTATTAGTCAGG
ILSTS005 F BTA10 GGAAGCAATTGAAATCTATAGCC 172–218 55
ILSTS005 R BTA10 TGTTCTGTGAGTTTGTAAGC
INRA063 F CHI18 GACCACAAAGGGATTTGCACAAGC 164–186 58
INRA063 R CHI18 AAACCACAGAAATGCTTGGAAG
INRABERN185 F CHI18 CAATCTTGCTCCCACTATGC 261–289 55
INRABERN185 R CHI18 CTCCTAAAACACTCCCACACTA
MAF065 F OAR15 AAAGGCCAGAGTATGCAATTAGGAG 116–158 58
MAF066 R OAR15 CCACTCCTCCTGAGAATATAACATG
MAF209 F CHI17 GATCACAAAAAGTTGGATACAACCGTG 100–104 55
MAF209 R CHI17 TCATGCACTTAAGTATGTAGGATGCTG
OarAE54 F OAR25 TACTAAAGAAACATGAAGCTCCCA 115–138 58
OarAE54 R OAR25 GGAAACATTTATTCTTATTCCTCAGTG
OarFCB20 F OAR2 GGAAAACCCCCATATATACCTATAC 93–112 58
OarFCB20 R OAR2 AAATGTGTTTAAGATTCCATACATGTG
SPS113 F BTA10 CCTCCACACAGGCTTCTCTGACTT 134–158 58
SPS113 R BTA10 CCTAACTTGCTTGAGTTATTGCCC
SRCRSP15 F Unknown CTTTACTTCTGACATGGTATTTCC 172–198 55
SRCRSP15 R Unknown TGCCACTCAATTTAGCAAGC
SRCRSP23 F Unknown TGAACGGGTAAAGATGTG 81–119 58
SRCRSP23 R Unknown TGTTTTTAATGGCTGAGTAG
SRCRSP5 F CHI21 GGACTCTACCAACTGAGCTACAAG 156–178 55
SRCRSP5 R CHI21 TGAAATGAAGCTAAAGCAATGC
SRCRSP7 F CHI6 TCTCAGCACCTTAATTGCTCT 117–131 55
SRCRSP7 R CHI6 GGTCAACACTCCAATGGTGAG
SRCRSP8 F Unknown TGCGGTCTGGTTCTGATTTCAC 215–255 55
SRCRSP8 R Unknown GTTTCTTCCTGCATGAGAAAGTCGATGCTTAG
SRCRSP9 F OAR17 AGAGGATCTGGAAATGGAATC 99–135 58
SRCRSP9 R OAR17 GCACTCTTTTCAGCCCTAATG
TCRVB6 F BTA10 GAGTCCTCAGCAAGCAGGTC 217–255 55
TCRVB6 R BTA10 CCAGGAATTGGATCACACCT

Table 3

Estimated values of genetic diversity indices at 16 loci for 18 black goat breeds

Loci NA HO HE PIC
CSRD247 26 0.68 0.73 0.69
ILSTS005 12 0.51 0.54 0.47
INRA063 15 0.71 0.72 0.67
INRABERN185 22 0.35 0.38 0.34
MAF065 23 0.73 0.77 0.73
MAF209 7 0.31 0.36 0.29
OarAE54 25 0.67 0.73 0.69
OarFCB20 20 0.63 0.68 0.63
SPS113 23 0.69 0.69 0.64
SRCRSP5 21 0.67 0.71 0.66
SRCRSP7 13 0.22 0.39 0.35
SRCRSP8 24 0.74 0.8 0.76
SRCRSP9 25 0.66 0.69 0.65
SRCRSP15 12 0.48 0.49 0.44
SRCRSP23 30 0.64 0.74 0.7
TCRVB6 30 0.7 0.72 0.68
Mean 20.5 0.59 0.63 0.59

NA, number of alleles; HO, observed heterozygosity; HE, expected heterozygosity; PIC, polymorphism information content.

Table 4

Diversity parameters in 18 Chinese black goat breeds

Breed Breed code N Allelic diversity Genetic diversity

TNA NEA±SD MNA±SD AR±SD NPA HO±SD HE±SD HWE FIS
Dazu DZ 44 85 2.81±1.24 5.31±2.30 4.41±1.62 0 0.586±0.1 0.59±0.18 0 0.001
Chuannan CN 39 90 2.99±1.26 5.63±2.00 4.64±1.52 0 0.58±0.20 0.60±0.21 4 0.034
Chuanzhong CZ 68 104 3.24±1.58 6.50±2.42 5.18±1.78 0 0.60±0.24 0.60±0.21 2 −0.003
Yudong YD 29 96 3.13±1.08 6.00±2.25 5.15±1.70 1 0.63±0.21 0.64±0.19 1 0.007
Baiyu BY 20 89 2.84±1.13 5.56±2.19 5.07±1.89 1 0.56±0.19 0.60±0.20 0 0.066
Jianchang JC 44 76 2.69±0.94 4.75±1.53 4.02±1.17 0 0.57±0.16 0.59±0.15 1 0.033
Meigu MG 33 153 4.11±1.57 9.56±4.19 7.26±2.45 51 0.46±0.21 0.74±0.10 13 0.376***
Chengde CD 35 95 2.91±1.42 5.94±2.38 4.96±1.85 3 0.49±0.26 0.56±0.25 6 0.122
Laiwu LW 31 119 4.18±1.70 7.44±2.10 6.53±1.78 10 0.68±0.19 0.73±0.13 3 0.070
Yimeng YM 36 141 3.90±2.10 8.81±3.58 6.72±2.63 13 0.59±0.22 0.65±0.23 5 0.100**
Fengqing FQ 24 79 2.65±0.90 4.93±1.88 4.39±1.52 5 0.57±0.22 0.59±0.16 4 0.033
Yunling YL 35 107 3.50±1.60 6.69±3.26 5.47±2.27 7 0.52±0.20 0.66±0.18 9 0.207**
Leizhou LZ 37 93 2.95±1.30 5.81±2.22 4.72±1.51 1 0.58±0.24 0.59±0.22 3 0.023
Lvliang LL 40 122 4.07±1.61 7.63±2.75 6.22±1.98 7 0.68±0.22 0.70±0.20 1 0.022
Macheng MC 36 98 3.33±1.54 6.13±2.16 5.20±1.66 0 0.61±0.20 0.64±0.17 2 0.045
Xiangdong XD 32 78 2.76±0.90 4.86±1.89 4.22±1.54 0 0.58±0.24 0.59±0.19 2 0.022
Guizhou GZ 40 99 3.29±1.18 6.19±2.56 5.16±1.77 0 0.63±0.16 0.66±0.13 3 0.049*
Ziwuling ZWL 38 113 4.06±1.73 7.06±2.11 5.99±1.74 4 0.67±0.22 0.69±0.19 2 0.040*
Mean 102.06 3.30±0.54 6.38±1.32 5.30±0.91 5.72 0.59±0.06 0.63±0.05 3.39

The p of FIS were obtained based on 1,023 random permutations.

*

indicates p<0.05,

**

indicates p<0.01, and

***

indicates p<0.001.

N, number of samples; TNA, total number of alleles; NEA, number of effective alleles; SD, standard deviation; MNA, mean number of alleles; AR, allelic richness; NPA, number of private alleles; HO, observed heterozygosity; HE, expected heterozygosity; HWE, the number of loci deviating from Hardy-Weinberg equilibrium; FIS, inbreeding coefficient.

Table 5

Pairwise differences in population averages (Slatkins linearized FST) using microsatellite markers

DZ CN CZ YD BY JC MG CD LW YM FQ YL LZ LL MC XD GZ ZWL
DZ 0
CN 0.0346* 0
CZ 0.0289* 0.0195* 0
YD 0.0352* 0.0247* 0.0191* 0
BY 0.0953* 0.1141* 0.096* 0.0797* 0
JC 0.0710* 0.0812* 0.0813* 0.0711* 0.0881* 0
MG 0.2642* 0.2659* 0.2684* 0.2407* 0.2500* 0.2501* 0
CD 0.3390* 0.3575* 0.3394* 0.3303* 0.3521* 0.3397* 0.2188* 0
LW 0.2648* 0.2831* 0.2620* 0.2533* 0.2850* 0.2707* 0.1233* 0.118* 0
YM 0.2936* 0.3091* 0.2999* 0.2846* 0.2966* 0.2942* 0.1708* 0.042* 0.0498* 0
FQ 0.3258* 0.3291* 0.3259* 0.3074* 0.3183* 0.2999* 0.162* 0.2272* 0.1744* 0.1855* 0
YL 0.2944* 0.2994* 0.2954* 0.2786* 0.2902* 0.2677* 0.1649* 0.1529* 0.0832* 0.1157* 0.1488* 0
LZ 0.0854* 0.0752* 0.072* 0.0596* 0.1184* 0.1301* 0.2658* 0.34* 0.2678* 0.2934* 0.3243* 0.2969* 0
LL 0.0813* 0.0772* 0.0675* 0.0624* 0.062* 0.0998* 0.2049* 0.2792* 0.2072* 0.2352* 0.2811* 0.2376* 0.0865* 0
MC 0.0304* 0.0342* 0.0144* 0.0254* 0.0875* 0.0697* 0.2367* 0.3176* 0.2370* 0.2717* 0.3007* 0.2684* 0.054* 0.0523* 0
XD 0.0736* 0.0736* 0.0693* 0.0647* 0.1093* 0.1151* 0.2696* 0.3259* 0.2729* 0.2858* 0.3232* 0.296* 0.0795* 0.0677* 0.0562* 0
GZ 0.0405* 0.0561* 0.042* 0.0335* 0.0586* 0.0324* 0.2248* 0.3026* 0.2262* 0.2628* 0.2787* 0.2454* 0.0862* 0.054* 0.0309* 0.0725* 0
ZWL 0.0777* 0.0818* 0.0727* 0.0565* 0.0501* 0.0929* 0.2006* 0.269* 0.2013* 0.2255* 0.2748* 0.2388* 0.0683* 0.0136* 0.0499* 0.055* 0.0524* 0
*

Indicates that the p-value is less than the corrected p-value (using the Bonferroni correction with a significance level of 0.05. A total of 110 operations were carried out when calculating the p-value of FST. The corrected p-value is 0.05/110 = 0.00045).

DZ, Dazu; CN, Chuannan; CZ, Chuanzhong; YD, Yudong; BY, Baiyu; JC, Jianchang; MG, Meigu; CD, Chengde; LW, Laiwu; YM, Yimeng; FQ, Fengqing; YL, Yunling; LZ, Leizhou; LL, Lvliang; MC, Macheng; XD, Xiangdong; GZ, Guizhou; ZWL, Ziwuling. (These are all breed names of Chinese native black goats.)