Go to Top Go to Bottom
Anim Biosci > Volume 38(11); 2025 > Article
Niu, Song, Chen, Xu, Chen, Lin, He, Liu, Zhang, and Yang: Plant essential oil supplementation promotes growth and attenuates lipopolysaccharide (LPS)-induced acute liver injury through SIRT1/PGC-1α signaling pathway in nursery pigs

Abstract

Objective

This study aimed to evaluate whether dietary supplementation with plant essential oil (PEO) and coated plant essential oil (CEO) could promote growth and alleviate liver oxidative damage in nursery piglets challenged with lipopolysaccharide (LPS) by modulating mitochondrial function in the liver.

Methods

Twenty-four 21-day-old piglets were randomly assigned to four groups, with six replicates per group. The CON and LPS groups received a basal diet, while the LPS+PEO and LPS+CEO groups were received the basal diet supplemented with 500 mg/kg of PEO and 500 mg/kg of CEO, respectively. The experimental period lasted for 28 days. On day 49, piglets in the LPS, LPS+PEO, and LPS+CEO groups were injected intraperitoneally with LPS at a dose of 100 μg/kg body weight, while those in the CON group received an equal volume of saline. All piglets were weighed and euthanized four hours after the LPS or saline injection. Blood and liver samples were collected for further analysis.

Results

Piglets in the LPS+PEO and LPS+CEO groups showed higher (p<0.05) average daily gain and better feed conversion ratio, and increased mRNA expressions of liver HO-1, NQO1 and Trx2 compared to the LPS and CON groups. Diet supplemented with PEO and CEO increased (p<0.05) the contents of immunoglobulin A (IgA), immunoglobulin G and immunoglobulin M (IgM), and the protein expressions of SIRT1 and PGC-1α in the liver of LPS-induced nursery piglets. Furthermore, piglets in the LPS+CEO group exhibited higher (p<0.05) levels of IgA, IgM, total antioxidant capacity, and the mRNA expressions of SOD2 and Trx2 in the liver than those of the LPS+PEO group.

Conclusion

Dietary supplementation with PEO or CEO improved growth performance in nursery piglets and alleviated LPS-induced liver oxidative damage in nursery piglets through activation of the SIRT1/PGC-1α signaling pathway. In addition, CEO supplementation demonstrated a more pronounced antioxidant effect than PEO.

INTRODUCTION

Weaned piglets are highly susceptible to oxidative stress due to a combination of abrupt dietary changes, immature antioxidant systems, gut microbiota dysbiosis, and stress-induced inflammation during the post-weaning period. The sudden transition from antioxidant-rich sow’s milk to solid feed reduces antioxidant intake, while their underdeveloped endogenous antioxidant systems are unable to neutralize excessive reactive oxygen species (ROS). Simultaneously, diet-induced gut microbiota dysbiosis promotes the proliferation of pathogenic bacteria, increasing the release of lipopolysaccharide (LPS), a toxin that exacerbates intestinal inflammation and permeability [1,2]. Additional stressors, such as social separation and environmental changes, elevate cortisol levels, further intensifying inflammation and ROS production, ultimately leading to oxidative stress in weaned piglets. Oxidative stress can damage mitochondrial DNA, disrupt protein structure, and impair mitochondrial and liver function [3]. Activating the SIRT1/PGC-1α pathway promotes mitochondrial biosynthesis, enhances energy metabolism, and combats oxidative stress. Oxidative stress also weakens hepatic antioxidant capacity, disrupts nutrient metabolism, and hinders animal growth, highlighting the importance of nutritional liver regulation in weaned piglets.
Plant essential oils (PEOs), aromatic secondary metabolites from plants, contain terpenoids and aromatic compounds with antibacterial, anti-inflammatory, antiviral, antioxidant, and immunomodulatory properties [4]. Recognized for their antioxidant potential, PEOs have become prominent feed additives. Thymol supplementation increased hepatic superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activity in grass carp [5], while carvacrol-thymol mixtures improved jejunal antioxidant enzyme levels and reduced ROS in piglets [6]. Cistus essential oils also repaired DNA damage and promoted mitochondrial biogenesis via SIRT1 and PGC-1α activation [7].
However, PEOs are volatile and prone to degradation from light, oxygen, and heat. Encapsulation offers protection by limiting oxygen exposure, reducing oxidation-related efficacy loss, and enhancing bioavailability and delivery efficiency [810]. Hydrophobic essential oils can form inclusion complexes with cyclodextrins, enhancing their water solubility and absorption in the body. This coating also protects the essential oils from the harsh gastrointestinal environment, enabling a gradual release in the small intestine where absorption occurs. Such controlled release markedly enhances bioavailability and maximizes the physiological benefits of essential oils [11]. Studies have shown that cinnamaldehyde nanoemulsion improves antioxidant enzyme activity and enhances both immunity and antioxidant status in Nile tilapia [12]. Likewise, nanoemulsions of tarragon essential oil demonstrated superior free radical scavenging and antioxidant capacity compared to uncoated forms [13].
Despite these findings, few studies have directly compared the effects of PEO and coated plant essential oils (CEO) on hepatic antioxidant activity in weaned piglets or explored their underlying mechanisms. Additionally, LPS is known to induce ROS production, leading to acute oxidative stress and mitochondrial dysfunction in hepatocytes [14]. Thus, in this study, an acute liver oxidative damage model was established by intraperitoneal injection of Escherichia coli LPS. The objective was to investigate whether dietary supplementation with PEO and CEO could promote growth performance in nursery piglets and attenuate liver oxidative damage of nursery piglets challenged with LPS. The findings aim to provide a theoretical foundation for the effective application of essential oils in piglet nutrition.

MATERIALS AND METHODS

Preparation of plant essential oil and coated plant essential oil

The PEO and CEO used in this study were supplied by Zhejiang Vegamax Biotechnology. Both PEO and CEO primarily consisted of 27% cinnamaldehyde, 9% thymol, and 4% vanillin. The remaining 60% comprised high-molecular-weight coating materials, including seaweed polysaccharides and porous starch.

Animals, diets and experimental design

A total of 24 nursery piglets ([Duroc×Landrace]×Large White; equal numbers of males and females), aged 21 days, were weaned and randomly assigned to four treatment groups, with six piglets per pen. The experiment lasted for 28 days. Piglets in the CON and LPS groups received a basal diet, while those in the LPS+PEO and LPS+CEO groups were fed the basal diet supplemented with 500 mg/kg of PEO and 500 mg/kg of CEO, respectively. The trial was conducted at Chia Tai Pig Industry, and all piglets had ad libitum access to feed and water throughout the experimental period. The composition and nutrient content of the basal diet for nursery piglets are presented in Table 1.

Sampling and preparation

On day 28 of the trial, piglets in the LPS, LPS+PEO, and LPS+CEO groups were weighed and injected intraperitoneally with E. coli LPS (strain O55:B5) at a dose of 100 μg/kg body weight. Piglets in the CON group received an equivalent volume of sterile saline. Four hours after the injections, all piglets were weighed again and blood samples were drawn into 10 mL procoagulant tubes collected via anterior vena cava puncture. Then all piglets were euthanized via intravenous administration of 30 mg/kg pentobarbital and exsanguinated after deep anesthesia. The abdominal cavity of each piglet was opened using a scalpel, and liver tissues were excised and weighed. Approximately 0.1 g of liver samples were placed into 2 mL transparent polypropylene cryogenic tubes, then stored at −80°C for subsequent use.

Growth performance

The body weight of each piglet was recorded at 21 and 49 days of age, prior to the LPS injection. Daily feed intake for each group was monitored over a 28-day period. At the end of the experiment, the average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (FCR) were calculated.

Liver injury index

The liver was gently lifted to separate the remaining connective tissues, then carefully excised and weighed to determine the liver index. The liver index was calculated using the following formula:
(1)
Liver index (g/kg)=Liver weight (g)/Live weight before slaughter (kg)

Liver injury markers analysis

Serum was isolated from blood samples via centrifugation at 3,500×g for 10 min at 4°C. The activities of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were measured according to the manufacturer’s instructions provided with the kits, which were purchased from Nanjing Jiancheng Bioengineering Research Institute.

Liver immune function analysis

Liver samples were homogenized in saline (wt: vol = 1: 9) using a homogenizer and then centrifuged at 4°C at 3,000×g for 10 min. The supernatant was collected for the measurement of immune and antioxidant indices. The contents of immunoglobulin A (IgA), immunoglobulin G (IgG), immunoglobulin M (IgM), interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α) in the liver were quantified using enzyme-linked immunosorbent assay (ELISA). The assays were conducted using kits from Nanjing Angle Gene Biotechnology.

Liver antioxidant index analysis

The activities of total antioxidant capacity (T-AOC), catalase (CAT), total superoxide dismutase (T-SOD), GSH-Px, and the concentration of malondialdehyde (MDA) in the liver were measured using kits from Nanjing Jiancheng Bioengineering Research Institute, following the manufacturer’s instructions.

Quantitative real-time polymerase chain reaction analysis

Total RNA from the liver was extracted following the manufacturer’s instructions for RNAiso Plus reagent (Takara Biomedical Technology). RNA concentration was measured using a Nano-300 microspectrophotometer. The concentration was recorded and adjusted to 500 ng/μL. A 1 μL aliquot of total RNA was reverse transcribed into cDNA using a polymerase chain reaction (PCR) instrument, in accordance with the instructions of the PrimeScript RT Reagent Kit (Takara) with gDNA Eraser. The primers used are shown in Table 2. Quantitative PCR was performed on a CFX96 fluorescence quantitative PCR instrument, following the instructions of the TB Premix EX Taq II (Takara). The reaction conditions were as follows: pre-denaturation at 95°C for 30 s, followed by 40 cycles of denaturation at 95°C for 5 s, and annealing/extension at 60°C for 30 s. Relative mRNA expression in the liver was calculated using the 2−ΔΔCT method, with β-actin serving as the internal reference gene.

Western blot analysis

Liver samples were homogenized using lysate (PMSF:NP-40 = 1:99) and centrifuged at 4°C at 16,000×g for 10 min to obtain the supernatant. Protein concentration was quantified using a BCA kit (Beyotime). After heat denaturation, proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and the separated protein bands were transferred to PVDF membranes. Following transfer, the membranes were blocked with 5% skimmed milk for 2 h. The membranes were then incubated overnight at 4°C with rabbit anti-PGC-1α monoclonal antibody (dilution 1:500; ABclonal), rabbit anti-SIRT1 monoclonal antibody (dilution 1:800; Abways), and rabbit anti-β-actin monoclonal antibody (dilution 1:5,000; Proteintech), respectively. Afterward, the membranes were incubated at room temperature for 1 h with horseradish peroxidase-conjugated anti-rabbit IgG (dilution 1:1,000; Beyotime). The signals of the target proteins were detected using a fluorescence imager (LAS-4000), and the grayscale values of the protein bands were analyzed using Gel Pro Analyzer 4.0 software. The relative expression of the target proteins was determined by calculating the ratio of the grayscale values of the SIRT1 and PGC-1α bands to that of the internal reference protein β-actin.

Statistical analysis

All data were statistically analyzed using SPSS 26.0 software (IBM). Each piglet was considered an experimental unit. Data were evaluated using one-way analysis of variance (ANOVA), followed by Duncan’s multiple range test for post hoc comparisons. Results are presented as mean±SEM, and differences were considered statistically significant at p<0.05.

RESULTS

Growth performance

As shown in Table 3, diets supplemented with PEO and CEO significantly increased (p<0.05) final body weight, ADG, and ADFI, while significantly improving (p<0.05) FCR in nursery piglets compared to the CON and LPS groups. Furthermore, piglets in the LPS+CEO group exhibited significantly higher (p<0.05) final body weight and ADG, and better (p<0.05) FCR than those in the LPS+PEO group.

The liver index

As shown in Figure 1, LPS significantly increased (p<0.05) the liver index compared to the CON group. However, among the LPS-challenged piglets, dietary supplementation with CEO significantly reduced (p<0.05) the liver index.

The liver function indicators in the serum

As shown in Figure 2, LPS significantly increased (p<0.05) the activities of ALT and AST compared to the CON group. In contrast, dietary supplementation with PEO significantly reduced (p<0.05) ALT activity in LPS-challenged piglets. Moreover, CEO supplementation significantly decreased (p<0.05) both ALT and AST activities compared to the LPS group.

The liver immune function

As presented in Table 4, LPS significantly reduced (p<0.05) the contents of IgA, IgG and IgM in the liver of nursery piglets, and significantly increased (p<0.05) the contents of IL-1β, IL-6 and TNF-α compared to CON group. In contrast, diet supplemented with PEO significantly increased (p<0.05) the contents of IgA and IgM in the liver of LPS-challenged nursery piglets. Dietary CEO supplementation showed increased (p<0.05) the contents of IgA, IgG and IgM in the liver of nursery piglets and decreased (p<0.05) the contents of IL-1β, TNF-α and IL-6 than piglets in LPS group. Moreover, LPS+ CEO group showed higher (p<0.05) concentrations of IgA and IgM than those of LPS+PEO group. As shown in Table 4, LPS significantly reduced (p<0.05) the hepatic contents of IgA, IgG, and IgM, and significantly increased (p<0.05) the levels of IL-1β, IL-6, and TNF-α compared to the CON group. In contrast, dietary supplementation with PEO significantly increased (p<0.05) the hepatic levels of IgA and IgM in LPS-challenged nursery piglets. Moreover, CEO supplementation significantly increased (p<0.05) the hepatic contents of IgA, IgG, and IgM, and decreased (p<0.05) the levels of IL-1β, TNF-α, and IL-6 compared to the LPS group. Piglets in the LPS+CEO group had significantly higher (p<0.05) concentrations of IgA and IgM than those in the LPS+PEO group.

The liver antioxidant index

As shown in Table 4, LPS significantly decreased (p<0.05) the hepatic activities of T-SOD, T-AOC, GSH-Px, and CAT, and significantly increased (p<0.05) the concentration of MDA in the liver of piglets compared to the CON group. In contrast, dietary supplementation with CEO significantly increased (p<0.05) the activities of T-SOD, T-AOC, GSH-Px, and CAT, and significantly reduced (p<0.05) the concentration of MDA compared to the LPS group. Furthermore, the T-AOC level in the LPS+CEO group was significantly higher (p<0.05) than that in the LPS+PEO group.

The relative mRNA expression levels of genes in the liver

As shown in Table 5, LPS significantly downregulated (p< 0.05) the mRNA expression levels of Keap1, HO-1, SOD1, SOD2, and CAT compared to the CON group. In contrast, dietary supplementation with PEO significantly upregulated (p<0.05) the mRNA expression of HO-1 and NQO1 in LPS-challenged piglets. Moreover, supplementation with CEO significantly upregulated (p<0.05) the mRNA expression of Nrf2, HO-1, NQO1, SOD2, and CAT compared with the LPS group. The LPS+CEO group also showed higher (p<0.05) mRNA expression of SOD2 than the LPS+PEO group. These antioxidant-related genes were further analyzed by Principal Component Analysis, which revealed that NQO1 (PC1 = 0.638; PC2 = −0.577) and HO-1 (PC1 = 0.600; PC2 = −0.477) were among the top principal contributors.
In addition, LPS significantly downregulated (p<0.05) the mRNA expression of SIRT1, PGC-1α, TFAM, and Trx2 compared to the CON group. In contrast, dietary supplementation with PEO significantly upregulated (p<0.05) the mRNA expression of Prx3 and Trx2 in LPS-challenged piglets. In addition, CEO supplementation significantly upregulated (p<0.05) the mRNA expression of SIRT1, PGC-1α, Nrf1, Prx3, Trx-R2, and Trx2 compared to the LPS group. Additionally, the mRNA expression levels of PGC-1α and Trx2 were significantly higher (p<0.05) in the LPS+CEO group than in the LPS+PEO group.

The protein expression levels of mitochondrial function in the liver

As shown in Figure 3, western blot analysis revealed that LPS significantly decreased (p<0.05) the relative protein expression levels of SIRT1 and PGC-1α in the liver compared to the CON group. In contrast, dietary supplementation with either PEO or CEO significantly upregulated (p<0.05) the protein expression of SIRT1 and PGC-1α compared to the LPS group.

DISCUSSION

A previous study demonstrated that dietary supplementation with a compound of carvacrol, cinnamaldehyde, and thymol significantly increased BW and ADG and reduced FCR in piglets compared to a basal diet [15]. In the present study, dietary supplementation with PEO and CEO, both containing 27% cinnamaldehyde, 9% thymol, and 4% vanillin, significantly improved ADG, ADFI, and final BW, while improving FCR in nursery piglets compared to the CON and LPS groups. These findings may be attributed to the ability of cinnamaldehyde and thymol to enhance feed palatability, thereby promoting feed intake and improving weight gain.
The liver plays a key role in metabolism, synthesis, detoxification, and immunity, with liver index serving as an indicator of its health. In this study, LPS significantly increased the liver index in nursery pigs, suggesting liver damage, consistent with the reports that LPS-induced oxidative stress causes hepatocyte swelling, intrahepatic hemorrhage, and liver enlargement [16]. In contrast, a CEO-supplemented diet reduced the liver index, indicating potential protective effects.
Serum ALT and AST activities, common markers of liver injury, were significantly elevated in the LPS group, confirming successful model induction. Essential oil-based plant feed additives like carvacrol, thymol, and cinnamaldehyde have previously been shown to lower AST and ALT levels in broilers [17], while cinnamaldehyde reduced these enzymes in Salmonella gallinarum-challenged chicks and alleviated liver inflammation [18]. Similarly, PEO reduced serum ALT, and CEO reduced both ALT and AST in LPS-challenged piglets in this study, likely by inhibiting the release of hepatic enzymes into the bloodstream through tissue repair mechanism. Due to microencapsulation, CEO offers greater stability and bioavailability than PEO, enhancing its hepatoprotective effects.
Excessive free radicals produced by oxidative stress stimulate immune cells, resulting in reduced immune function, thereby releasing proinflammatory cytokines and initiating inflammatory responses. The immunoglobulins, such as IgA, IgG, and IgM, are involved in regulating inflammatory responses and eliminating pathogens. As proinflammatory cytokines, IL-6, IL-1β, and TNF-α may lead to chronic inflammatory states and disruption of biological homeostasis [19]. Adding thymol, carvacrol and eugenol to the diet can increase the IgG titer and total antibody titer of broiler chickens, produce immunostimulatory effects, and enhance humoral immune responses [20,21]. Oregano essential oil can increase the levels of IgA and IgM in the blood of calves, effectively enhance the specific immune response ability of calves, and improve the immune status [22]. Li et al [23] reported that a capsule essential oil product containing thymol and cinnamaldehyde can increase the levels of IgA and IgM in weaned piglets. Adding cinnamaldehyde to the diet can significantly reduce the levels of IL-6, IL-1β and TNF-α in serum and tissues, indicating that the diet supplemented with cinnamaldehyde can protect and reduce LPS-induced inflammation, resist the invasion of LPS, and show good anti-inflammatory function [24]. Previous research results have shown that thymol regulates the inflammatory state of weaned piglets by inhibiting the release of LPS-induced inflammatory mediators, thereby exerting an anti-inflammatory effect [25]. In the current study, supplementation with PEO and CEO significantly increased IgM and IgA levels in the liver, while CEO additionally elevated IgG and decreased IL-6, IL-1β, and TNF-α concentrations. These findings indicate that both PEO and CEO enhance humoral immunity and mitigate inflammatory responses in LPS-challenged piglets. This immunomodulatory effect is likely due to the promotion of immunoglobulin synthesis and secretion by immune cells, which subsequently suppressed the expression and release of pro-inflammatory cytokines. The encapsulated form of essential oils, CEO, owing to its improved storage stability and bioavailability, exerted more pronounced anti-inflammatory effects than the free form, PEO.
The level of T-AOC serves as a key indicator of the body’s overall ability to resist oxidative stress and reflects the antioxidant status. Antioxidant enzymes such as CAT, T-SOD, and GSH-Px play critical roles in neutralizing harmful free radicals and reducing oxidative damage, while MDA is a reliable biochemical marker for oxidative stress [26]. A previous study reported that dietary supplementation with essential oils increased the activities of CAT, T-SOD, and T-AOC, and reduced MDA concentrations in the intestines of weaning pigs challenged by K88 E. coli, thereby enhancing their antioxidant capacity [27]. Cinnamaldehyde was also shown to improve antioxidant status and alleviate oxidative damage in the kidneys and heart by increasing the activities of T-SOD, CAT, and GSH-Px and decreasing MDA levels [28,29]. In the present study, CEO supplementation significantly increased the activities of T-SOD, T-AOC, GSH-Px, and CAT, and decreased the hepatic MDA content in LPS-challenged nursery piglets. These findings suggested that CEO enhanced the antioxidant defense system by promoting free radical scavenging. This effect may be associated with the ability of essential oils to boost antioxidant enzyme activity, which helps to mitigate damage to the electron transport chain and supports mitochondrial oxidative phosphorylation and biofunction.
The Nrf2/HO-1 signaling pathway is essential for maintaining redox homeostasis, as it counteracts oxidative stress and prevents cellular damage. Under oxidative stress, Nrf2 translocates to the nucleus, where it promotes the transcription of antioxidant genes and activates several downstream antioxidant enzymes [30]. Among these, NQO1 and HO-1 are key Nrf2-regulated enzymes that synergistically combat oxidative stress. As such, NQO1 detoxifies quinones and stabilizes antioxidants, while HO-1 produces bilirubin and carbon monoxide, both of which reduce ROS levels and suppress inflammation [31]. Previous studies have shown that eugenol alleviated transmissible gastroenteritis virus-induced reductions in Nrf2, HO-1, and NQO1 protein expression in IPEC-J2 cells [32], and that OEO upregulated both mRNA and protein levels of nuclear Nrf2 and SOD1 in H2O2-treated IPEC-J2 cells, indicating a protective role against intestinal oxidative damage through activation of the Nrf2 pathway [33]. Consistent with these findings, our results demonstrated that dietary supplementation with both PEO and CEO significantly upregulated the hepatic mRNA expression of HO-1 and NQO1 in LPS-challenged piglets. Moreover, CEO supplementation further enhanced the expression of Nrf2, SOD2, and CAT compared to the LPS group. These results suggest that essential oils activated Nrf2 signaling, facilitating its nuclear translocation and thereby inducing the expression of downstream antioxidant genes and promoting antioxidant enzyme production. Consequently, PEO and CEO contributed to improved antioxidant capacity and maintenance of redox balance in the liver. PEOs, due to their volatile nature, are susceptible to oxidative degradation and environmental factors such as oxygen exposure, light, and thermal stress. Encapsulation technologies involving cross-linking have been shown to improve the physicochemical properties of essential oils. These technologies enhance the stability of essential oils by minimizing rapid evaporation and degradation of active components, and improve their solubility in aqueous environments, thereby increasing their bioavailability and antioxidant efficacy [8,9]. As a result, CEO exhibited a stronger protective effect against liver dysfunction than PEO.
Mitochondria are multifunctional organelles that actively regulate cellular metabolism, various cellular functions, and maintain intracellular homeostasis. The electron transport chain on the mitochondrial inner membrane generates ROS, which subsequently triggers redox reactions [34]. However, excessive ROS can lead to oxidative stress. The mitochondrial thioredoxin system, which includes Trx2, Trx-R2, and Prx3, is a crucial non-enzymatic antioxidant system responsible for regulating mitochondrial redox homeostasis. As a key regulator of antioxidant defense and mitochondrial biogenesis, PGC-1α enhances mitochondrial oxidative phosphorylation and helps maintain cellular energy metabolic homeostasis. The histone deacetylase SIRT1 activates PGC-1α through deacetylation, thereby improving mitochondrial function and promoting liver health [35]. Additionally, Nrf1, a nuclear transcription factor and downstream target of the SIRT1/PGC-1α pathway, is involved in maintaining redox balance in the liver and protecting cells from oxidative stress [36]. Previous studies have demonstrated that cinnamaldehyde [37] and carvacrol [38] upregulated the expression of PGC-1α and SIRT1, respectively, suggesting that essential oils may positively influence liver antioxidant activity via the SIRT1/PGC-1α signaling pathway. In the present study, supplementation with both PEO and CEO reversed the downregulation of Prx3 and Trx2. Furthermore, the diet supplemented with CEO significantly upregulated the mRNA expression of SIRT1, PGC-1α, Nrf1, and Trx-R2 in LPS-challenged piglets. Further determination of the expression of key proteins in the mitochondrial function signaling pathway revealed that diet supplemented with PEO and CEO significantly upregulated the relative protein expression of SIRT1 and PGC1-α in the liver of LPS-challenged piglets. The above data indicate that the diet supplemented with PEO and CEO may increase mitochondrial biosynthesis and activity through the SIRT1/PGC1-α signaling pathway. The mRNA expression of PGC-1α and Trx2 in the LPS+CEO group was higher than that in the LPS+PEO group, suggesting that CEO has stronger mitochondrial antioxidant function, which may be due to the encapsulation technology protecting the essential oil from enzymatic degradation, allowing it to reach the small intestine for absorption, thereby improving bioavailability.

CONCLUSION

In summary, this study demonstrated that both PEO and CEO can improve the growth performance of nursery piglets, reduce liver damage, enhance immune function by increasing immunoglobulin content and reducing inflammatory factor concentrations. Moreover, these supplements enhance antioxidant capacity by increasing antioxidant enzyme activity, antioxidant-related gene mRNA expression, and mitochondrial function key protein expression. The above results show that the addition of PEO and CEO to the diet has the therapeutic potential to reduce LPS-induced liver oxidative damage in nursery piglets by regulating the SIRT1/PGC-1α signaling pathway, and the improvement effect of CEO is better than that of PEO.

Notes

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

AUTHORS’ CONTRIBUTION

Conceptualization: Niu Y, Yang C.

Data curation: Song X, Chen Y.

Formal analysis: Niu Y, Song X.

Methodology: Niu Y, Liu J, Yang C.

Software: Song X, Chen Y.

Validation: He J, Liu J, Zhang R.

Investigation: Song X, Xu Y, Lin Q.

Writing - original draft: Niu Y, Yang C.

Writing - review & editing: Niu Y, Song X, Chen Y, Xu Y, Chen Y, Lin Q, He J, Liu J, Zhang R, Yang C.

FUNDING

This research was funded by the Key Agricultural Enterprise Project of Zhejiang Province (2022C02059), Natural Science Foundation of Zhejiang Province (LQ23C170002), the Key R & D Program of Zhejiang Province (2024C04016), and Zhejiang A and F University Student Research Training Program (2023KX093).

ACKNOWLEDGMENTS

Not applicable.

SUPPLEMENTARY MATERIAL

Not applicable.

DATA AVAILABILITY

Upon reasonable request, the datasets of this study can be available from the corresponding author.

ETHICS APPROVAL

The experimental procedures were conducted in accordance with the guidelines approved by the Administrative Regulation of the Zhejiang A&F University Experimental Animal Centre (ZAFUAC2022006).

DECLARATION OF GENERATIVE AI

No AI tools were used in this article.

Figure 1
The effect of dietary supplementation with plant essential oil (PEO) and coated plant essential oil (CEO) on the liver index of nursery piglets challenged by lipopolysaccharide (LPS). CON, control group, piglets fed the basal diet and injected with 100 μg/kg BW saline; LPS, piglets fed the basal diet and injected with LPS at a dose of 100 μg/kg body weight; LPS+PEO, piglets fed the basal diet supplemented with 500 mg/kg PEO and injected with LPS; LPS+CEO, piglets fed the basal diet supplemented with 500 mg/kg CEO and injected with LPS. a,b Means with different superscript differ significantly (p<0.05).
ab-25-0066f1.jpg
Figure 2
The effect of dietary supplementation with plant essential oil (PEO) and coated plant essential oil (CEO) on the activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the serum of nursery piglets challenged by lipopolysaccharide (LPS). CON, control group, piglets fed the basal diet and injected with 100 μg/kg BW saline; LPS, piglets fed the basal diet and injected with LPS at a dose of 100 μg/kg body weight; LPS+PEO, piglets fed the basal diet supplemented with 500 mg/kg PEO and injected with LPS; LPS+CEO, piglets fed the basal diet supplemented with 500 mg/kg CEO and injected with LPS. a–c Means with different superscript differ significantly (p<0.05).
ab-25-0066f2.jpg
Figure 3
Effect of dietary supplementation with plant essential oil (PEO) and coated plant essential oil (CEO) on the protein expression levels of SIRT1/PGC-1α signaling pathway in the liver of nursery piglets challenged by lipopolysaccharide (LPS). CON, control group, piglets fed the basal diet and injected with 100 μg/kg BW saline; LPS, piglets fed the basal diet and injected with LPS at a dose of 100 μg/kg body weight; LPS+PEO, piglets fed the basal diet supplemented with 500 mg/kg PEO and injected with LPS; LPS+CEO, piglets fed the basal diet supplemented with 500 mg/kg CEO and injected with LPS. a–c Means with different superscript differ significantly (p<0.05). PGC-1α, peroxisome proliferator-activated receptor γ coactivator 1α; SIRT1, silent information regulator 1.
ab-25-0066f3.jpg
Table 1
Ingredient and analyzed chemical compositions of control diets (as-fed basis)
Item Content
Ingredient (%)
 Corn 57.70
 Soybean meal (CP 46%) 12.50
 Swelling corn 8.00
 Full-fat soybean 8.00
 Fermented soybean meal 4.00
 Whey powder 3.00
 Fish meal (CP 67%) 3.00
 Calcium hydrogen phosphate 1.80
 Limestone powder 0.50
L-Lysine (98%) 0.30
L-Threonine (98%) 0.10
DL-Methionine (98%) 0.08
 Wheat middling 0.02
 Premix1) 1
 Total 100
Analyzed composition (%)
 Digestive energy (MJ/kg) 14.04
 Crude protein 18.36
 Lysine 1.28
 Methionine 0.45
 Methionine+cystine 0.72
 Threonine 0.83
 Calcium 0.81
 Total phosphorus 0.69

1) Premix provided per kilogram of diet: Vitamin A, 13,000 IU; Vitamin D3, 3,100 IU; α-Tocopherol, 55 mg; Vitamin K3, 4.2 mg; Vitamin B1, 5 mg; Vitamin B2, 13 mg; Vitamin B6, 8 mg; Vitamin B12, 0.07 mg; Niacin acid, 35 mg; Pantothenic acid, 17 mg; Folic acid, 0.3 mg; Biotin, 0.08 mg; Choline chloride, 500 mg; Fe (FeSO4·H2O), 130 mg; Cu (CuSO4·5H2O) 10 mg; Zn (ZnO), 150 mg; I (KIO3), 0.4 mg; Mn (MnSO4·H2O), 8 mg; Se (Na2SeO3), 0.5 mg.

Table 2
Primer sequences for fluorescent quantitative PCR
Gene names Forward primer (5’→3’) Reverse primer (5’→3’) Accession number
CAT AGCTTTGCCCTTGCACAAAC TCCATATCCGTTCATGTGCCTGTG NM_214301.2
SOD1 AAGGCCGTGTGTGTGCTGAA GATCACCTTCAGCCAGTCCTTT NM_001190422.1
SOD2 GGCCTACGTGAACAACCTGA TGATTGATGTGGCCTCCACC NM_214127.2
GSH-Px CCTCAAGTACGTCCGACCAG GTGAGCATTTGCGCCATTCA NM_214201.1
SIRT1 GGCAGGAGAAGGAAACAATGG GTCGTCGTCGTCGTAGAAGTC NM_001145750.2
PGC-1α ACAACACGGACAGAACTGAGG GCATCACAGGTATAACGGTAGGT NM_213963.2
Nrf1 TATTCTGCTGTGGCTGATGGAGAG GCTTGCGTTGTCTGGATGGTC XM_021079000.1
TFAM TCCTCCTCCTTCGTCGTAGTC AGGCACTATGGGAAATCAGTCAAC NM_001130211.1
Nrf2 GCCCCTGGAAGCGTTAAAC GGACTGTATCCCCAGAAGGTTGT XM_005671981.3
Keap1 TGCACGCTGCGATGGAG GGGGTTCCAGATGACAAGGG NM_001114671.1
HO-1 AGCACTCACAGCCCAACAG GTACAAGGACGCCATCACC NM_001004027.1
NQO1 TGCTTACACATACGCTGCCA CGTGGATACCCTGCAGAGAG NM_001159613.1
Trx-R2 GCACCTGCGTGAATGTTG GCCCTCCAGTAGCGATGA NM_001168702.1
Trx2 GACAGAAGTGCCCTTGA AGCCATCTCCCAGCAAC NM_001243705.1
Prx3 TATCCGACATGTGAGTGCCG CCACAGCACACTTGTCAAGC NM_001244531.1
β-actin CTACACCGCTACCAGTTCGC TAGGAGTCCTTCTGGCCCAT XM_021086047.1

PCR, polymerase chain reaction; CAT, catalase; SOD1, superoxide dismutase 1; SOD2, superoxide dismutase 2; GSH-Px, glutathione peroxidase; SIRT1, silent information regulator 1; PGC-1α, peroxisome proliferator-activated receptor γ coactivator 1α; Nrf1, nuclear factor erythroid 2-related factor 1; TFAM, mitochondrial transcription factor A; Nrf2, nuclear factor E2-related factor 2; Keap1, Kelch-like ECH-associated protein 1; HO-1, heme oxygenase 1; NQO1, NAD(P)H quinone oxidoreductase 1; Trx-R2, thioredoxin reductase 2; Trx2, thioredoxin 2; Prx3, peroxiredoxin 3.

Table 3
The effect of dietary supplementation with plant essential oil (PEO) and coated plant essential oil (CEO) on growth performance of nursery piglets
Item Treatment groups SEM p-value

CON LPS LPS+PEO LPS+CEO
BW 21 d (kg) 6.83 6.80 6.82 6.80 0.03 0.979
BW 49 d (kg) 16.45c 16.53c 17.62b 18.92a 0.22 <0.001
ADG (g) 343.45c 347.62c 385.72b 426.79a 7.11 <0.001
ADFI (g) 533.33c 540.17bc 562.27ab 577.00a 5.07 0.002
FCR (g/g) 1.55a 1.56a 1.46b 1.35c 0.02 <0.001

CON, control group, piglets fed the basal diet and injected with 100 μg/kg BW saline; LPS, piglets fed the basal diet and injected with LPS at a dose of 100 μg/kg body weight; LPS+PEO, piglets fed the basal diet supplemented with 500 mg/kg PEO and injected with LPS; LPS+CEO, piglets fed the basal diet supplemented with 500 mg/kg CEO and injected with LPS.

a–c Means in the same row with different superscript differ significantly (p<0.05).

LPS, lipopolysaccharide; BW, body weight; ADG, average daily gain, ADFI, average daily feed intake; FCR, feed conversion ratio.

Table 4
The effect of dietary supplementation with plant essential oil (PEO) and coated plant essential oil (CEO) on the immune function and antioxidant activity in the liver of nursery piglets challenged by lipopolysaccharide (LPS)
Item Treatment groups SEM p-value

CON LPS LPS+PEO LPS+CEO
Immune function
 IgA (mg/g protein) 21.07a 13.04d 15.07c 18.02b 0.67 <0.001
 IgG (mg/g protein) 79.64a 60.35c 65.93b 70.43b 1.63 <0.001
 IgM (mg/g protein) 21.05a 13.07d 15.80c 18.07b 0.67 <0.001
 IL-1β (ng/g protein) 39.20b 51.23a 46.11ab 44.47b 1.46 0.008
 IL-6 (μg/g protein) 9.64c 12.35a 11.50ab 10.37bc 0.27 <0.001
 TNF-α (μg/g protein) 0.74c 0.90a 0.85ab 0.78b 0.02 <0.001
Antioxidant activity
 T-AOC (U/mg protein) 9.27a 6.55b 7.05b 8.51a 0.27 <0.001
 T-SOD (U/mg protein) 12.69a 9.31c 9.97bc 11.42ab 0.34 <0.001
 GSH-Px (U/mg protein) 90.37a 72.45c 77.84bc 83.43ab 1.63 <0.001
 CAT (U/mg protein) 8.64a 6.30c 7.01bc 7.84ab 0.22 <0.001
 MDA (μmol/g protein) 0.72c 0.88a 0.81ab 0.75bc 0.02 <0.001

CON, control group, piglets fed the basal diet and injected with 100 μg/kg BW saline; LPS, piglets fed the basal diet and injected with LPS at a dose of 100 μg/kg body weight; LPS+PEO, piglets fed the basal diet supplemented with 500 mg/kg PEO and injected with LPS; LPS+CEO, piglets fed the basal diet supplemented with 500 mg/kg CEO and injected with LPS.

a–c Means in the same row with different superscript differ significantly (p<0.05).

IgA, immunoglobulin A; IgG, immunoglobulin G; IgM, immunoglobulin M; IL-1β, interleukin-1β; TNF-α, tumor necrosis factor-α; IL-6, interleukin-6; T-AOC, total antioxidant capacity; T-SOD, total superoxide dismutase; GSH-Px, glutathione peroxidase; CAT, catalase; MDA, malondialdehyde.

Table 5
The effect of dietary supplementation with plant essential oil (PEO) and coated plant essential oil (CEO) on the relative mRNA expression levels to the control of 1.0 in the liver of nursery piglets challenged by lipopolysaccharide (LPS)
Item Treatment groups SEM p-value

CON LPS LPS+PEO LPS+CEO
Antioxidant related genes
Nrf2 1.00b 0.63b 1.14ab 1.66a 0.12 0.011
Keap1 1.00a 0.27b 0.25b 0.32b 0.07 <0.001
HO-1 1.00c 0.43d 1.76a 1.43b 0.11 <0.001
NQO1 1.00b 0.53b 2.11a 2.37a 0.23 0.003
SOD1 1.00a 0.38b 0.69ab 0.87ab 0.08 0.014
SOD2 1.00ab 0.34c 0.73bc 1.16a 0.08 <0.001
CAT 1.00a 0.29b 0.58ab 0.96a 0.09 0.007
GSH-Px 1.00 0.71 0.91 1.32 0.09 0.129
Mitochondrial function related genes
SIRT1 1.00a 0.42b 0.73ab 1.00a 0.08 0.012
PCG-1α 1.00ab 0.41c 0.63bc 1.36a 0.10 <0.001
Nrf1 1.00ab 0.60b 0.85ab 1.36a 0.09 0.006
TFAM 1.00a 0.51b 0.63ab 0.90ab 0.07 0.027
Prx3 1.00ab 0.66b 1.42a 1.48a 0.10 0.005
Trx-R2 1.00ab 0.63b 1.19ab 1.41a 0.11 0.083
Trx2 1.00c 0.64d 1.30b 1.89a 0.10 <0.001

CON, control group, piglets fed the basal diet and injected with 100 μg/kg BW saline; LPS, piglets fed the basal diet and injected with LPS at a dose of 100 μg/kg body weight; LPS+PEO, piglets fed the basal diet supplemented with 500 mg/kg PEO and injected with LPS; LPS+CEO, piglets fed the basal diet supplemented with 500 mg/kg CEO and injected with LPS.

a–d Means in the same row with different superscript differ significantly (p<0.05).

Nrf2, nuclear factor E2-related factor 2; Keap1, Kelch-like ECH-associated protein 1; HO-1, heme oxygenase 1; NQO1, NAD(P)H quinone oxidoreductase 1; SOD1, superoxide dismutase 1; SOD2, superoxide dismutase 2; CAT, catalase; GSH-Px, glutathione peroxidase; SIRT1, silent information regulator 1; PGC-1α, peroxisome proliferator-activated receptor γ coactivator 1α; Nrf1, nuclear factor erythroid 2-related factor 1; TFAM, mitochondrial transcription factor A; Prx3, peroxiredoxin 3; Trx-R2, thioredoxin reductase 2; Trx2, thioredoxin 2.

REFERENCES

1. Yin J, Wu MM, Xiao H, et al. Development of an antioxidant system after early weaning in piglets. J Anim Sci 2014;92:612–9. https://doi.org/10.2527/jas.2013-6986
crossref pmid
2. Zhou M, Wu Z, Deng D, et al. Effects of taurine on the growth performance, diarrhea, oxidative stress and intestinal barrier function of weanling piglets. Front Vet Sci 2024;11:1436282. https://doi.org/10.3389/fvets.2024.1436282
crossref pmid pmc
3. Zarkovic N. Roles and functions of ROS and RNS in cellular physiology and pathology. Cells 2020;9:767. https://doi.org/10.3390/cells9030767
crossref pmid pmc
4. Anthony KP, Deolu-Sobogun SA, Saleh MA. Comprehensive assessment of antioxidant activity of essential oils. J Food Sci 2012;77:C839–43. https://doi.org/10.1111/j.1750-3841.2012.02795.x
crossref pmid
5. Morselli MB, Reis JH, Baldissera MD, et al. Benefits of thymol supplementation on performance, the hepatic antioxidant system, and energetic metabolism in grass carp. Fish Physiol Biochem 2020;46:305–14. https://doi.org/10.1007/s10695-019-00718-2
crossref pmid
6. Wei HK, Xue HX, Zhou ZX, Peng J. A carvacrol–thymol blend decreased intestinal oxidative stress and influenced selected microbes without changing the messenger RNA levels of tight junction proteins in jejunal mucosa of weaning piglets. Animal 2017;11:193–201. https://doi.org/10.1017/S1751731116001397
crossref pmid
7. Ledrhem M, Nakamura M, Obitsu M, et al. Essential oils derived from Cistus species activate mitochondria by inducing SIRT1 expression in human keratinocytes, leading to senescence inhibition. Molecules 2022;27:2053. https://doi.org/10.3390/molecules27072053
crossref pmid pmc
8. Choi J, Wang L, Gong J, et al. Evaluating the in vitro release of essential oils from microparticles in simulated swine gastric and intestinal fluids and the essential oil stability in microparticles during feed pelleting process. J Anim Sci 2019;97:70. https://doi.org/10.1093/jas/skz258.145
crossref
9. Zhao Q, Gao YS, Jin F, Zhu LY. Preparation process optimization and performance characterization of feed plant essential oil microcapsules. Molecules 2022;27:7096. https://doi.org/10.3390/molecules27207096
crossref pmid pmc
10. Homayonpour P, Jalali H, Shariatifar N, Amanlou M. Effects of nano-chitosan coatings incorporating with free/nano-encapsulated cumin (Cuminum cyminum L.) essential oil on quality characteristics of sardine fillet. Int J Food Microbiol 2021;341:109047. https://doi.org/10.1016/j.ijfoodmicro.2021.109047
crossref pmid
11. Hu J, Peng K, Guo J, et al. Click cross-linking-improved waterborne polymers for environment-friendly coatings and adhesives. ACS Appl Mater Interfaces 2016;8:17499–510. https://doi.org/10.1021/acsami.6b02131
crossref pmid
12. Abd El-Hamid MI, Ibrahim SM, Eldemery F, et al. Dietary cinnamaldehyde nanoemulsion boosts growth and transcriptomes of antioxidant and immune related genes to fight Streptococcus agalactiae infection in Nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol 2021;113:96–105. https://doi.org/10.1016/j.fsi.2021.03.021
crossref pmid
13. Azizkhani M, Jafari Kiasari F, Tooryan F, Shahavi MH, Partovi R. Preparation and evaluation of food-grade nanoemulsion of tarragon (Artemisia dracunculus L.) essential oil: antioxidant and antibacterial properties. J Food Sci Technol 2021;58:1341–8. https://doi.org/10.1007/s13197-020-04645-6
crossref pmid
14. Wang F, Liu J, Hu X, et al. The influence on oxidative stress markers, inflammatory factors and intestinal injury-related molecules in Wahui pigeon induced by lipopolysaccharide. PLOS ONE 2021;16:e0251462. https://doi.org/10.1371/journal.pone.0251462
crossref pmid pmc
15. Zhao BC, Wang TH, Chen J, et al. Effects of dietary supplementation with a carvacrol–cinnamaldehyde–thymol blend on growth performance and intestinal health of nursery pigs. Porcine Health Manag 2023;9:24. https://doi.org/10.1186/s40813-023-00317-x
crossref pmid pmc
16. Martens M, Kumar MM, Kumar S, et al. Quantitative analysis of organ tissue damage after septic shock. Am Surg 2007;73:243–8. https://doi.org/10.1177/000313480707300309
crossref pmid
17. Reis JH, Gebert RR, Barreta M, et al. Effects of phytogenic feed additive based on thymol, carvacrol and cinnamic aldehyde on body weight, blood parameters and environmental bacteria in broilers chicken. Microb Pathog 2018;125:168–76. https://doi.org/10.1016/j.micpath.2018.09.015
crossref pmid
18. Yin L, Hussain S, Tang T, et al. Protective effects of cinnamaldehyde on the oxidative stress, inflammatory response, and apoptosis in the hepatocytes of Salmonella gallinarum-challenged young chicks. Oxid Med Cell Longev 2022;2022:2459212. https://doi.org/10.1155/2022/2459212
crossref pmid pmc
19. Kaur S, Bansal Y, Kumar R, Bansal G. A panoramic review of IL-6: structure, pathophysiological roles and inhibitors. Bioorg Med Chem 2020;28:115327. https://doi.org/10.1016/j.bmc.2020.115327
crossref pmid
20. Hashemipour H, Kermanshahi H, Golian A, Veldkamp T. Effect of thymol and carvacrol feed supplementation on performance, antioxidant enzyme activities, fatty acid composition, digestive enzyme activities, and immune response in broiler chickens. Poult Sci 2013;92:2059–69. https://doi.org/10.3382/ps.2012-02685
crossref pmid
21. Li L, Chen X, Zhang K, et al. Effects of thymol and carvacrol eutectic on growth performance, serum biochemical parameters, and intestinal health in broiler chickens. Animals 2023;13:2242. https://doi.org/10.3390/ani13132242
crossref pmid pmc
22. Luo Z, Liu T, Cairang D, et al. Oregano essential oil as a natural plant additive affects growth performance and serum antibody levels by regulating the rumen microbiota of calves. Animals 2024;14:820. https://doi.org/10.3390/ani14060820
crossref pmid pmc
23. Li SY, Ru YJ, Liu M, Xu B, Péron A, Shi XG. The effect of essential oils on performance, immunity and gut microbial population in weaner pigs. Livest Sci 2012;145:119–23. https://doi.org/10.1016/j.livsci.2012.01.005
crossref
24. Abou El-Ezz D, Maher A, Sallam N, El-Brairy A, Kenawy S. Trans-cinnamaldehyde modulates hippocampal Nrf2 factor and inhibits amyloid beta aggregation in LPS-induced neuroinflammation mouse model. Neurochem Res 2018;43:2333–42. https://doi.org/10.1007/s11064-018-2656-y
crossref pmid
25. Omonijo FA, Liu S, Hui Q, et al. Thymol improves barrier function and attenuates inflammatory responses in porcine intestinal epithelial cells during lipopolysaccharide (LPS)-induced inflammation. J Agric Food Chem 2019;67:615–24. https://doi.org/10.1021/acs.jafc.8b05480
crossref pmid
26. Dalle-Donne I, Rossi R, Colombo R, Giustarini D, Milzani A. Biomarkers of oxidative damage in human disease. Clin Chem 2006;52:601–23. https://doi.org/10.1373/clinchem.2005.061408
crossref pmid
27. Yan H, Xing Q, Xiao X, et al. Effect of Saccharomyces cerevisiae postbiotics and essential oil on growth performance and intestinal health of weanling pigs during K88 ETEC infection. J Anim Sci 2024;102:1–16. https://doi.org/10.1093/jas/skae007
crossref
28. Sharma UK, Kumar R, Gupta A, Ganguly R, Pandey AK. Renoprotective effect of cinnamaldehyde in food color induced toxicity. 3 Biotech 2018;8:212. https://doi.org/10.1007/s13205-018-1241-z
crossref pmid pmc
29. Ismail BS, Mahmoud B, Abdel-Reheim ES, et al. Cinnamaldehyde mitigates atherosclerosis induced by high-fat diet via modulation of hyperlipidemia, oxidative stress, and inflammation. Oxid Med Cell Longev 2022;2022:4464180. https://doi.org/10.1155/2022/4464180
crossref pmid pmc
30. Ulasov AV, Rosenkranz AA, Georgiev GP, Sobolev AS. Nrf2/Keap1/ARE signaling: towards specific regulation. Life Sci 2022;291:120111. https://doi.org/10.1016/j.lfs.2021.120111
crossref pmid
31. Lou Y, Zou L, Shen Z, et al. Protective effect of dexmedetomidine against delayed bone healing caused by morphine via PI3K/Akt mediated Nrf2 antioxidant defense system. Front Pharmacol 2024;15:1396713. https://doi.org/10.3389/fphar.2024.1396713
crossref pmid pmc
32. Wang K, Tang Y, Wu X, et al. Eugenol attenuates transmissible gastroenteritis virus-induced oxidative stress and apoptosis via ROS-NRF2-ARE signaling. Antioxidants 2022;11:1838. https://doi.org/10.3390/antiox11091838
crossref pmid pmc
33. Zou Y, Wang J, Peng J, Wei H. Oregano essential oil induces SOD1 and GSH expression through Nrf2 activation and alleviates hydrogen peroxide-induced oxidative damage in IPEC-J2 cells. Oxid Med Cell Longev 2016;2016:5987183. https://doi.org/10.1155/2016/5987183
crossref pmid pmc
34. Pizzino G, Irrera N, Cucinotta M, et al. Oxidative stress: harms and benefits for human health. Oxid Med Cell Longev 2017;2017:8416763. https://doi.org/10.1155/2017/8416763
crossref pmid pmc
35. Singh V, Ubaid S. Role of silent information regulator 1 (SIRT1) in regulating oxidative stress and inflammation. Inflammation 2020;43:1589–98. https://doi.org/10.1007/s10753-020-01242-9
crossref pmid
36. Li Y, Feng YF, Liu XT, et al. Songorine promotes cardiac mitochondrial biogenesis via Nrf2 induction during sepsis. Redox Biol 2021;38:101771. https://doi.org/10.1016/j.redox.2020.101771
crossref pmid
37. Zuo J, Zhao D, Yu N, et al. Cinnamaldehyde ameliorates diet-induced obesity in mice by inducing browning of white adipose tissue. Cell Physiol Biochem 2017;42:1514–25. https://doi.org/10.1159/000479268
crossref pmid
38. Kim E, Choi Y, Jang J, Park T. Carvacrol protects against hepatic steatosis in mice fed a high-fat diet by enhancing SIRT1-AMPK signaling. Evid Based Complement Alternat Med 2013;2013:290104. https://doi.org/10.1155/2013/290104
crossref pmid pmc


Editorial Office
Asian-Australasian Association of Animal Production Societies(AAAP)
Room 708 Sammo Sporex, 23, Sillim-ro 59-gil, Gwanak-gu, Seoul 08776, Korea   
TEL : +82-2-888-6558    FAX : +82-2-888-6559   
E-mail : editor@animbiosci.org               

Copyright © 2026 by Asian-Australasian Association of Animal Production Societies.

Developed in M2PI

Close layer
prev next