Go to Top Go to Bottom
Anim Biosci > Volume 38(6); 2025 > Article
Wei, Qi, Wang, Qu, Yan, Li, Wang, Sun, Sun, and Liang: Fisetin alleviates oxidative stress and promotes porcine early embryonic development via activation of the NRF2-ARE signalling pathway

Abstract

Objective

We improved the developmental capacity of porcine early embryos via supplementation with fisetin during in vitro culture (IVC). In addition, we investigated the antioxidant mechanism of fisetin via activation of the NRF2-ARE signalling pathway in porcine early embryos.

Methods

Fisetin (0, 1, 2.5 and 5 μM) was supplemented during IVC to observe its effects on the developmental ability of porcine parthenogenetic activation (PA), in vitro fertilization (IVF) and somatic cell nuclear transfer (SCNT) embryos. The effects of fisetin supplementation on the antioxidant capacity, mitochondrial function, cell proliferation and apoptosis levels of porcine PA embryos were detected via fluorescence staining, and the expression levels of genes related to apoptosis, pluripotency and the NRF2 pathway were also examined.

Results

Compared with the control, 1 μM fisetin during IVC increased the developmental ability of porcine PA, IVF and SCNT embryos. Additionally, fisetin significantly decreased reactive oxygen species (ROS) and apoptosis levels; increased pluripotency during embryonic development, cell proliferation and glutathione levels; and improved mitochondrial function in PA embryos. Moreover, the levels of Kelch-like ECH-associated protein 1 (KEAP1) significantly decreased, and the levels of NFE2-like bZIP transcription factor 2 (NRF2) and its downstream antioxidant enzymes significantly increased after fisetin supplementation.

Conclusion

Our data reveal that fisetin protects porcine early embryos from oxidative stress during IVC by activating the NRF2-ARE signalling pathway, thereby improving the success of in vitro embryo production.

INTRODUCTION

High-quality embryos, a prerequisite for successful early embryonic development and subsequent postnatal development, constitute the material basis for the onset of life. However, in most instances, embryos obtained via in vitro culture (IVC) are usually of lower quality and quantity than those produced in vivo [1]. This phenomenon occurs due to a lack of physiological defence mechanisms, the presence of multiple potential sources of reactive oxygen species (ROS) or a lack of natural antioxidants to control basal ROS levels [2]. These differences may lead to a greater risk of oxidative stress in vitro than in vivo. Compared with other species, porcine embryos contain a large amount of energy-storing lipids and are more sensitive to the environment and susceptible to oxidative stress, thereby leading to a reduction in the quality of the embryos cultured in vitro [3]. Therefore, antioxidant supplementation may be beneficial for early embryonic development during IVC.
Numerous studies have demonstrated that flavonoids can maintain intracellular redox homeostasis not only by directly eliminating intracellular ROS but also by fortifying the cellular antioxidant defence system [4]. Fisetin is a flavonoid found in many vegetables, fruits and teas, especially in apples, strawberries, mangoes and onions [5]. It was previously shown to have various biological properties, such as antioxidant [6], anti-inflammatory [7], anticancer [8] and neuroprotective [9] properties. Fisetin is a well-studied antioxidant reported to protect against cell damage caused by oxidative stress by inhibiting ROS production [10,11], thereby maintaining the protective effect of the nonenzymatic defence system glutathione (GSH). Fisetin can increase the expression of antioxidant-related enzymes by activating the NFE2-like bZIP transcription factor 2 (NRF2)-mediated signalling pathway, thereby alleviating the oxidative stress caused by traumatic brain injury (TBI) [5,12].
NRF2 is a key transcription factor in cells that plays a central role in regulating the expression of many antioxidant genes [1315]. Under normal physiological conditions, NRF2 binds to Kelch-like ECH-associated protein 1 (KEAP1), is ubiquitinated by the KEAP1-cul3 E3 ligase complex and is rapidly degraded by the 26S proteasome in the cytoplasm [16]. Thus, this rapid turnover keeps NRF2 at low levels and prevents NRF2 translocation to the nucleus [15]. Under oxidative stress conditions, critical modifications to the cysteine residues of KEAP1 cause a conformational change, leading to disruption of KEAP1-NRF2 binding and preventing the degradation of NRF2 [17]. At this point, NRF2 enters the nucleus and binds to antioxidant response elements (AREs) to initiate the transcription of downstream genes. This process is facilitated by cAMP-response element binding protein (CREB) and transcriptional activation [18]. Upon exposure to oxidative stressors, NRF2 activates the transcription of a series of antioxidant and phase II detoxifying enzymes, such as haem oxygenase 1 (HO-1), superoxide dismutase 1 (SOD1), catalase (CAT), glutathione peroxidase 4 (GPX4), glutamate-cysteine ligase catalytic subunit (GCLC), glutamate-cysteine ligase modifier subunit (GCLM), and NAD(P)H quinone dehydrogenase 1 (NQO1) [1921], which quench ROS. To date, only a few studies have focused on the effects of fisetin on animal reproduction, particularly early embryonic development. Hence, we studied the NRF2-mediated antioxidant pathway to explore the effects of fisetin on porcine early embryonic development. The results of our study provide insights into the embryonic IVC system and a theoretical basis for increasing the quality of porcine early embryos.
Given the important role of antioxidants in the in vitro development of early embryos, we explored the effects of fisetin on the development of porcine embryos produced in vitro after parthenogenetic activation (PA), in vitro fertilization (IVF) and somatic cell nuclear transfer (SCNT). In addition, we evaluated the effects of fisetin on mitochondrial function, pluripotency, cell proliferation, apoptosis and the antioxidant capacity of porcine PA embryos and confirmed the antioxidant mechanism of fisetin in porcine PA embryos via the NRF2-ARE signalling pathway.

MATERIALS AND METHODS

Chemicals

All chemical reagents used in the study were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise specified. Fisetin (purity: 98.39%; MedChemExpress, Shanghai, China) was dissolved in dimethyl sulfoxide (DMSO; MedChemExpress; Concentration of use<0.1%) and then diluted to the specific concentrations used in the experiment.

Collection of porcine oocytes and in vitro maturation

Porcine ovaries were collected from slaughterhouses and delivered to the laboratory within 1–2 h in a normal saline solution of 0.9 wt.% NaCl at 37°C. The selected 3–8 mm follicles were aspirated with a 10 mL syringe to collect cumulus–oocyte complexes (COCs). After washing with preheated phosphate-buffered saline containing 0.1% polyvinyl alcohol (PBS-PVA) 3 times, COCs with homogeneous cytoplasm and at least three intact layers of surrounding cumulus cells were selected under a stereomicroscope (Stemi 305; ZEISS, Oberkochen, Germany). A total of 80–100 COCs were transferred to each well of a 4-well plate (JET BIOFIL, Guangzhou, China) containing 500 μL of medium. The components of the mature media used were tissue culture medium (TCM)-199 (TCM-199; Invitrogen, Carlsbad, CA, USA), epidermal growth factor (10 ng/mL), luteinizing hormone (10 IU/mL; NSHF, Ningbo, China), follicle-stimulating hormone (10 IU/mL; NSHF), sodium pyruvate (0.91 mM), follicular fluid (10%) and penicillin/streptomycin (1%). Finally, the cell medium was covered with 400 μL of mineral oil. The COCs were cultured in an incubator at 38.5°C with 5% CO2 and saturated humidity for 42 to 44 h.
After in vitro maturation, the COCs were digested with 0.1% hyaluronidase to remove the surrounding expanded cumulus crown cells. Oocytes with a uniform ooplasm and an excreted first polar body were subjected to subsequent experiments.

Parthenogenetic activation, somatic cell nuclear transfer, in vitro fertilization and embryonic in vitro culture

PA, IVF and SCNT procedures were performed according to our previous study [22,23]. For PA, oocytes excreting polar bodies were activated twice at 120 V/mm direct-current pulses for 60 μs and then transferred to microdroplets of Cytochalasin B (HY-16928; MedChemExpress) to equilibrate for 3 to 5 h. For IVF, the use of fresh porcine semen and the density of spermatozoa were adjusted to 1×106/mL. Oocytes excreting polar bodies and diluted spermatozoa were incubated together in an incubator for 6 h to fertilize the oocytes, after which spermatozoa attached to the surface of the oocytes were blown off by blowing in IVC solution. For SCNT, the nuclei of the oocytes were first removed, and then a single porcine fibroblast subjected to 48 h of starvation was inserted as a nuclear donor into the perivitelline space of the enucleated oocyte. The reconstructed oocytes were cycled 3 times for fusion under the parameters of 120 V/mm for 30 μs. They were placed in IVC solution and incubated in an incubator for 3 h to check and remove unfused embryos.
Following PA, SCNT and IVF, the embryos were washed in porcine zygote medium (PZM)-5. Approximately 50 embryos were then transferred to a 500 μL suspension containing bicarbonate-buffered PZM-5 and bovine serum albumin (4 mg/mL), which was covered with 400 μL of mineral oil. Fisetin was added to the IVC medium at final concentrations of 0, 1, 2.5 and 5 μM, and the cells were cultured continuously in a 4-well plate at 38.5°C, 5% CO2 and saturated humidity for 6 days without changing the medium during culture.

Quantitative real-time polymerase chain reaction

Total RNA was extracted from porcine early embryos via the TRIzel (YY101; Epizyme, Shanghai, China) method. Next, MonScriptTM RTIII All-in-one Mix with dsDNase (MR05101M; Monad, Jiangsu, China) was used to reverse transcribe the total RNA into cDNA. Quantitative real-time polymerase chain reaction was performed using MonAmpTM ChemoHS qPCR Mix (MQ00401S; Monad) in a CFX Duet Real-Time PCR System (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. The reaction conditions were 95°C for 10 min, 95°C for 10 s, 60°C for 10 s and 72°C for 30 s for a total of 40 cycles. Table 1 shows complete information on the qPCR primers used in this study, which were synthesized by Sangon Biotech, and GAPDH was used as a reference gene.

EdU incorporation assay and Hoechst staining

Blastocyst proliferation was evaluated using a BeyoClick EdU-555 cell proliferation assay kit (C0075S; Beyotime, Shanghai, China). Briefly, porcine blastocysts that developed from PA embryos were incubated in the dark for 2 h at 10 μM EdU at 38.5°C in air with 5% CO2 and saturated humidity. After incubation, the samples were washed with PBS-PVA 3 times for 5 min each time and then fixed with 4% paraformaldehyde for 15 min. After fixation, the samples were washed with PBS-PVA 3 times and then permeated with immunostaining permeabilization buffer supplemented with saponin (P0095; Beyotime) for 10 min. Afterwards, the samples were fully washed with PBS-PVA, stained with azide 555 solution for 30 min, and washed with PBS-PVA 3 times. Afterwards, the blastocysts were placed on slides, 10 μg/mL Hoechst33342 was added, and the samples were incubated for 10 min in the dark. EdU-positive cells were observed under a fluorescence microscope and analysed via NIH ImageJ 1.8.0 software (National Institutes of Health, Bethesda, MD, USA).

TUNEL assay

Blastocyst apoptosis was detected using a one-step TUNEL apoptosis assay kit (MA0223; MeilunBio, Dalian, China). Briefly, porcine blastocysts were first fixed in 4% paraformaldehyde for 1 h and then washed 3 times with PBS-PVA. The samples were then permeated in immunostaining permeabilization buffer with saponin (P0095; Beyotime) for 10 min, washed with PBS-PVA 3 times and incubated at 37°C with TUNEL assay solution for 1 h. Then, the incubated blastocysts were washed 3 times with PBS-PVA and evenly placed on slides, and an appropriate amount of 10 μg/mL Hoechst33342 was added to the slides and incubated for 10 min in the dark. The total number of apoptotic nuclei in the porcine blastocysts was analysed via ImageJ software, and apoptosis was evaluated according to the percentage of apoptotic nuclei in the blastocysts.

Immunofluorescence

Porcine blastocysts that developed to day 6 were fixed with 4% paraformaldehyde for 30 min at room temperature and then washed 3 times with PBS-PVA for 5 min/wash, followed by 3 washes with PBS-PVA for each subsequent operation. Permeabilization was performed via incubation with Enhanced Immunostaining Permeabilization Buffer (P0097; Beyotime) for 30 min at room temperature. The incubator was closed for 1 h using QuickBlock Blocking Buffer for Immunol Staining (P0260; Beyotime) for 1 h in an incubator. NRF2 (1:300, 16396-1-AP; Proteintech, Wuhan, China) and KEAP1 (1:300, 60027-1-Ig; Proteintech) were both mixed, and small drops were made into which the embryos were transferred and incubated overnight at 4°C; Cy3-conjugated Goat Anti-Rabbit IgG (H+L) (1:100, SA00009-2; Proteintech) and Fluorescein-conjugated Goat Anti-Mouse IgG (H+L) (1:100, SA00003-1; Proteintech) were mixed, and the embryos were transferred to the samples, which were incubated at room temperature for 1 h. Finally, the incubated blastocysts were evenly placed on slides, and an appropriate amount of 10 μg/mL Hoechst33342 was added to the slides and incubated for 10 min in the dark. The signal intensities were observed under a confocal microscope (Zeiss), and the fluorescence intensities were quantified via ImageJ software.

Western blotting

Embryos that developed to day 6 (n = 80/per replicate) were collected for WB analysis. The prepared embryo samples were treated with a lysis buffer composed of ddH2O, 0.5 mM Tris-HCl, 50% glycerol, 10% sodium dodecyl sulfate, bromophenol blue and β-mercaptoethanol. The protein was extracted at 95°C for 10 min. After protein denaturation, Omni-Easy One-step Colour polyacrylamide gel electrophoresis Gel (PG212 or PG213; Epizyme) with an appropriate molecular weight was selected to separate the protein samples in electrophoretic buffer, and then the proteins were transferred to a polyvinylidene fluoride membrane (PVDF; IPVH000101, Immobilon; Merck, Darmstadt, Germany). The PVDF membrane was blocked with protein-free rapid blocking buffer (PS180P; Epizyme) at room temperature for 30 min and washed with TBST 3 times for 10 min each, followed by 3 washes for 10 min with TBST for each subsequent operation. After incubation with the primary antibody at 4°C overnight. The membrane was subsequently incubated with the secondary antibody for 1 h at room temperature. After sufficient Omni-ECL Femto Light Chemiluminescence reagent (SQ201; Epizyme) was added to the PVDF membrane, images of the protein bands were captured with a Tanon5200 imaging system (Tanon, Shanghai, China). The immunoblots were analysed with ImageJ software. Please refer to Table 2 for complete information on the antibodies used in this study.

Reactive oxygen species and glutathione staining

To determine the intracellular ROS and GSH levels, embryos that developed to the 4 cell stage and blastocyst stage were separately treated with a ROS assay kit (S0033S; Beyotime) and CellTracker fluorescent probes (C12881; Thermo Fisher Scientific, Waltham, MA, USA). The embryos were incubated in PBS-PVA containing 10 μM 2′,7′-DCFH or 10 μM 4-CMF2HC for 15 or 30 min, respectively. After the incubated embryos were washed three times in PBS-PVA, the fluorescence signals of ROS and GSH were captured in jpg format via a digital camera connected to a fluorescence microscope, and the fluorescence intensity was analysed via ImageJ software.

Mitochondrial membrane potential assay

The mitochondrial membrane potential (MMP) was determined in 4 cell stage and blastocyst stage PA embryos by MitoTracker Red CMXRos staining. Following the manufacturer’s guidelines, MitoTracker Red CMXRos dye (C1035; Beyotime) was used to dilute the solution to 200 nM, and the embryos were incubated at 37°C for 30 min. After 3 washes with PBS-PVA, red fluorescence TIFF-formatted images were observed and captured via fluorescence microscopy, and the fluorescence intensity was analysed via ImageJ software.

Adenosine triphosphate level measurements

The adenosine triphosphate (ATP) levels of porcine 4 cell stage and blastocyst-stage PA embryos were determined via an enhanced ATP assay kit (S0027; Beyotime). According to the instructions, 80 to 120 porcine embryos were collected, 200 μL of ATP lysis buffer was added to fully lyse the cells, the cells were centrifuged at 12,000×g for 5 min at 4°C, and the supernatant was collected for subsequent analysis. ATP test diluent was added to the ATP test reagent at a ratio of 4:1 to prepare the ATP test working liquid. Then, 100 μL of ATP detection reagent was added to a 96-well plate and incubated for 3 to 5 min to consume the ATP substrate, after which 20 μL of the standard solution was added. The mixture was thoroughly mixed and immediately tested. The emitted light signal was measured with a microplate reader (Tecan, Shanghai, China).

Molecular docking

The binding of fisetin to the KEAP1 protein was evaluated using molecular docking analysis. The molecular structure of fisetin (PubChem CID: 5281614) was retrieved from the PubChem database (https://pubchem.ncbi.nlm.nih.gov/), and the 3D molecular structure of the KEAP1 (PDB ID: 7K2A) protein was retrieved from the PDB database (https://www.rcsb.org/). According to a previous standard protocol [24], several essential steps, such as molecular force field optimization, the addition of hydrogens, the deletion of water molecules, and the elimination of unrelated protein chains and proto-ligands from protein structures, are needed. After the ligand was optimized, semiflexible docking was used for docking, and images were prepared via PyMOL version 2.3.0. AutoDock Vina 1.2.0 was used for molecular docking to obtain the docking binding free energy as well as the docking result file.

Statistical analysis

At least three independent biological replicates were used for each experiment. The results were first normalized for fluorescent staining, mRNA, protein and ATP. Then, GraphPad 9.5.0 software (GraphPad, San Diego, CA, USA) was used to evaluate the normal distribution of the data, and then the ANOVA and an independent sample t test were used for the statistical analysis of the data that passed the Shapiro–Wilk test. The Mann‒Whitney test was used for the statistical analysis of data that did not pass the Shapiro‒Wilk test. The data are expressed as the mean±standard error, and p<0.05 was considered to indicate statistical significance.

RESULTS

Fisetin promoted porcine parthenogenetic activation embryo development and increased blastocyst quality

To determine the optimal concentration of fisetin, the IVC medium was supplemented with 0, 1, 2.5, or 5 μM fisetin. We found that the 48 h cleavage rate of embryos treated with 1 μM fisetin increased from 81.59% to 84.36% (Figures 1A, 1B; 84.36±6.06% vs. 81.59±3.47%; p>0.05), and the blastocyst formation rate increased from 35.85% to 45.06% (Figures 1C, 1D; 45.06±8.23% vs. 35.85±7.50%; p<0.05) compared with the control group. Additionally, the blastocyst diameter in the 1 μM fisetin group was significantly greater than that in the control group (Figures 1E, 1F; 154.06±1.57 vs. 146.46±1.53; p<0.05). On the basis of the above results, 1 μM was selected as the optimum concentration of fisetin, and subsequent experiments were conducted with the control and 1 μM fisetin groups. The number of blastocysts increased significantly after fisetin treatment (Figures 1G, 1H; 49.72±1.35 vs. 44.90±1.35; p<0.05). The results showed that supplementation with fisetin during IVC promoted the development of porcine PA embryos.

Fisetin improved the developmental potential of porcine in vitro fertilization and SCNT embryos

Although PA embryos are commonly used as models for in vitro embryo development studies, it has different characteristics than IVF and SCNT embryos do. Therefore, we evaluated the effects of fisetin treatment on the formation and quality of blastocysts in porcine IVF and SCNT embryos. Compared with that of the control group, the blastocyst formation rate of fisein treated IVF embryos increased from 20.84% to 31.98% (Figures 2A, 2C; 31.98±1.17% vs. 20.84±1.54%; p<0.05), and SCNT embryos increased from 17.12% to 25.92% (Figures 2D, 2F; 25.92±3.05% vs. 17.12±2.38%; p<0.05), both of which significantly increased, whereas the 48 h cleavage rate increased but not significantly (Figures 2A, 2B, 2D, 2E; 88.37± 4.57% vs. 78.30±3.31%; 90.52±3.39% vs. 81.08±2.70%; p>0.05). In addition, after the embryos were treated with fisetin, the blastocyst diameter and the number of blastocyst cells of the IVF embryos significantly increased (Figures 2G–2I; 150.02± 1.71 vs. 143.03±2.33; 47.86±1.68 vs. 42.82±1.62; p<0.05, p<0.01). The differences in blastocyst diameter and the number of blastocyst cells were not significant among the SCNT embryos (Figures 2J–2L; 140.90±1.98 vs. 132.12±4.38, 41.00±3.01 vs. 33.82±2.35; p>0.05). The results indicated that fisetin supplementation during IVC could also promote the development of porcine IVF and SCNT embryos, which is consistent with the results obtained for PA embryos.

Fisetin enhanced the pluripotency of porcine parthenogenetic activation blastocysts

The normal expression of pluripotent genes can ensure the normal development and differentiation of embryos and is also an important index for measuring the quality of blastocysts. Compared with those in the control group, the mRNA levels of the Octamer-binding transcription factor (OCT4; p<0.01), Nanog homeobox (NANOG; p<0.05), SRY-box transcription factor 2 (SOX2; p<0.05) and Caudal type homeobox 2 (CDX2; p<0.01) genes related to pluripotency during embryonic development were upregulated to varying degrees (Figure 3). The results showed that fisetin enhanced the pluripotency of porcine PA embryos.

Fisetin promoted cell proliferation and inhibited apoptosis in porcine parthenogenetic activation blastocysts

EdU staining revealed that fisetin strongly increased cell proliferation in porcine PA embryos (Figures 4A, 4B; 37.76± 1.91% vs. 27.18±1.75%; p<0.001), and TUNEL staining revealed that fisetin significantly decreased apoptosis in porcine PA embryos (Figures 4C, 4D; 1.66±0.26% vs. 3.67±0.45%; p<0.01). Moreover, fisetin significantly reduced the mRNA and protein levels of BAX (Figures 4E, 4H; p<0.01, p<0.05), and the mRNA levels of BCL2 and BCL2/BAX were increased (Figures 4F, 4G; p<0.01, p<0.001); The protein levels of BCL2/BAX were increased (Figure 4J; p<0.05), but the protein levels of BCL2 didn’t significantly change (Figure 4I; p>0.05). The results showed that fisetin can increase the proliferation and inhibit the apoptosis of cells in porcine PA embryos.

Fisetin increased antioxidant capacity and improved mitochondrial function in porcine parthenogenetic activation embryos

Excessive ROS accumulation can cause oxidative stress in porcine early embryos and cause mitochondrial dysfunction. Therefore, we examined the ROS, GSH, MMP and ATP levels in the 4 cell stage and blastocyst stage of porcine PA embryos. The results revealed that the ROS levels were significantly lower (Figures 5A–5C; p<0.001), and the GSH levels were significantly greater (Figures 5D–5F; p<0.001) in the fisetin group compared with the control group. In addition, the MMP was significantly elevated (Figures 5G–5I; p<0.001), and the mitochondrial ATP levels were significantly increased (Figures 5J, 5K; p<0.001, p<0.01) in the fisetin group. The results indicated that fisetin increased the antioxidant capacity and improved mitochondrial function in porcine PA embryos. Fisetin is a natural compound with excellent antioxidant effects, and our results demonstrated that fisetin increased the antioxidant capacity and improved the mitochondrial function of porcine PA embryos, which may be the main role of fisetin in the IVC of early porcine embryos.

Fisetin reduces the risk of oxidative stress in porcine parthenogenetic activation embryos via the NRF2-ARE signalling pathway

Studies have shown that the NRF2-ARE signalling pathway is the main pathway by which fisetin exerts its antioxidant effects [12]. We first performed molecular docking prediction of fisetin and the KEAP1 protein. The results revealed that fisetin has multiple binding sites for KEAP1 and a binding energy of -7.5 kcal/mol (Figure 6A), indicating that fisetin likely affects the structure and bioactivity of the KEAP1 protein. To further determine the relationship between fisetin and the NRF2-ARE signalling pathway, we detected NRF2 and KEAP1 via IF and found that the level of NRF2 was significantly elevated and that of KEAP1 was significantly decreased in the fisetin group (Figures 6B, 6C; p<0.01), and also the mRNA of NRF2 was significantly increased and KEAP1 was significantly decreased (Figure 6D; p<0.001, p<0.01). The combination of qPCR and WB revealed that the levels of the NRF2 downstream related antioxidant enzymes HO-1, SOD1, CAT and GPX4 were significantly elevated (Figure 6E; p<0.05), as did the mRNA levels of GCLC (p<0.01), GCLM (p<0.05) and NQO1 (p<0.001) (Supplement 1). These results indicate that fisetin improves the antioxidant capacity of porcine early embryos via activation of the NRF2-ARE signalling pathway.

DISCUSSION

Early embryonic development, which requires a large amount of energy, is a critical period for new life. Mitochondrial oxidative phosphorylation generates more than 90% of all ATP. [25,26]. Moreover, mitochondrial oxidative phosphorylation of ATP is produced along with the generation of ROS [27]. In vivo, antioxidants in follicular and oviductal fluids protect embryos from oxidative stress, whereas in vitro, embryos rely on their own antioxidant defence mechanisms, including antioxidant enzymes and the nonenzymatic defence system GSH, to prevent oxidative stress [28]. Because oxidative stress plays a critical role in early embryonic development, we explored whether fisetin protects early embryonic development by inhibiting oxidative stress. However, the quality of porcine in vitro-produced embryos still falls short in comparison with that of in vivo-derived embryos [29], so it is crucial to continue to search for effective antioxidants, improve the IVC system, and explore its use for in vitro production of early porcine embryos. In this study, we investigated the effects of fisetin on porcine early embryo development and the potential underlying mechanisms involved. Our results revealed that fisetin inhibits oxidative stress via activation of the NRF2-ARE signalling pathway, which promotes the development of porcine early embryos (Figure 7).
Previous studies have proposed that fisetin, a known antioxidant, abrogates oxidative stress and augments the endogenous antioxidant defence system. On the one hand, fisetin acts as an ROS scavenger, reducing ROS production [30]; on the other hand, fisetin can affect the activity of oxidant enzymes such as xanthine oxidase and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, preventing excessive ROS production [31]. In this study, fisetin reduced intracellular ROS levels and increased GSH levels after IVC. Numerous studies using zebrafish [32], H9c2 cells [33] and bovine endometrial epithelial cell lines [34] have shown that fisetin can increase the cellular antioxidant capacity during in vitro induction culture. A reduced MMP and compromised mitochondrial function are indicators of ROS accumulation and apoptosis in early embryos [35], which account for their developmental retardation. Additionally, reports indicate that the NRF2/ARE transcriptional pathway is the master regulator of the response to mitochondrial dysfunction. NRF2 has beneficial effects on mitochondrial biogenesis and function [36]. Our data showed that fisetin supplementation effectively alleviated mitochondrial dysfunction by eliminating excess ROS, thereby inhibiting apoptosis.
Excessive ROS accumulation can induce cellular damage and apoptosis, which may lead to embryonic development arrest [28]. In the present study, we found that fisetin significantly increased the expression of genes related to pluripotency, the diameter of blastocysts and the number of blastocysts in porcine early embryos. We then wanted to determine whether the increase in cell proliferation and decrease in apoptosis induced by fisetin supplementation would increase the quality of porcine early embryos. Fisetin effectively reduces the corticosterone-mediated generation of ROS and inhibits corticosterone-induced cell death in PC12 cells [37]. Furthermore, other empirical studies have shown that fisetin suppresses neuronal cell death and apoptosis, increases the expression of BCL2, and decreases the expression of BAX and caspase-3 after TBI [12]. Similarly, our findings revealed that fisetin treatment increased cell proliferation and decreased apoptosis in porcine early embryos.
Previous research has reported a protective role of NRF2 in porcine parthenote embryos, particularly in embryos cultured under metabolically stressful conditions [38]. Many subsequent studies have demonstrated that NRF2 is activated and plays a protective role in mammalian embryonic development. For example, luteolin-mediated activation of the NRF2/KEAP1 signalling pathway contributes to the increased production of porcine embryos with high developmental competence [39]. Moreover, maternal exposure to hyperbaric oxygen at the early stage upregulated NRF2-NOTCH1-CDX2 expression, thereby inducing apoptosis and impairing inner cell mass specification [40]. We speculate that fisetin mitigates oxidative stress in porcine early embryos via activating the NRF2-ARE signalling pathway.
To verify our hypothesis, we first predicted the binding of fisetin to KEAP1 using molecular docking and then examined the associated proteins and mRNAs. Our results are consistent with the speculation that the mRNA and protein expression levels of KEAP1 were significantly downregulated, combined with the results of molecular docking of fisetin with KEAP1, indicating that fisetin may prevent proteasomal degradation of the NRF2 protein by interfering with the KEAP1-dependent E3 ubiquitin activity, allowing NRF2 to translocate to the nucleus and resulting in increased accumulation of NRF2 in the nucleus. This finding is consistent with previous reports that fisetin promotes the translocation of NRF2 from the cytoplasm to the nucleus, thereby enhancing its ability to bind to AREs [12]. Moreover, the expression of the antioxidant enzymes HO-1, GPX4, SOD1 and CAT downstream of the NRF2-ARE pathway was significantly elevated, and the mRNAs of GCLC, GCLM and NQO1 were significantly upregulated. However, the detailed mechanisms by which fisetin activates the NRF2 pathway have not been fully elucidated and need to be investigated in future studies.

CONCLUSION

In this study, we demonstrated for the first time that fisetin was able to protect early porcine embryos by activating the NRF2-ARE signalling pathway against oxidative stress. These results may provide a promising strategy for optimizing the porcine IVC system and provide insights into the role of the NRF2-ARE signalling pathway in porcine early embryogenesis. Our findings can provide a theoretical basis for improving the yield of porcine embryos produced in vitro and for preserving endangered porcine breeds.

Notes

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

AUTHORS’ CONTRIBUTION

Conceptualization: Wei HK, Qi JJ, Sun BX, Liang S

Data curation: Wei HK, Qi JJ, Wang YQ, Yan CX, Li TT

Formal analysis: Wei HK, Qi JJ, Sun H

Methodology: Wei HK, Qi JJ, Wang YQ, Qu HX, Yan CX, Li TT, Wang Y, Sun BX, Liang S

Software: Wei HK, Qi JJ, Wang YQ

Validation: Wei HK, Qi JJ

Investigation: Wei HK, Qi JJ

Writing - original draft: Wei HK, Qi JJ

Writing - review & editing: Wei HK, Qi JJ, Wang YQ, Qu HX, Yan CX, Li TT, Wang Y, Sun H, Sun BX, Liang S.

FUNDING

This research was funded by the Jilin Scientific and Technological Development Program of China (20230202066NC), Graduate Innovation Fund (2024CX293) and Innovative Training Program (S202410183759) of Jilin University.

ACKNOWLEDGMENTS

Not applicable.

DATA AVAILABILITY

Upon reasonable request, the datasets of this study can be available from the corresponding author.

ETHICS APPROVAL

Not applicable.

DECLARATION OF GENERATIVE AI

No AI tools were used in this article.

SUPPLEMENTARY MATERIAL

Supplementary file is available from: https://doi.org/10.5713/ab.0691
Supplement 1. Relative expression of GCLC, GCLM and NQO1 mRNAs in porcine PA blastocysts
ab-24-0691-Supplementary-1.pdf

Figure 1
Fisetin promoted the development of porcine parthenogenetic activation (PA) embryos. (A, C) Representative images of porcine PA embryonic development at 48 h and on day 6 (6 d) in the control and different concentrations of fisetin groups; scale bar = 200 μm. (B, D) 48 h cleavage rates and 6 d blastocyst formation rates of porcine PA embryos. (E) 6 d blastocyst images obtained after supplementation with different concentrations of fisetin; scale bar = 200 μm. (F, H) Average diameter and total cell number in blastocysts. (G) Representative fluorescence images of Hoechst33342-stained blastocysts; scale bar = 50 μm. The data are expressed as the mean±SEM of at least three independent experiments. Asterisks above the bars indicate significant differences from the control group (* p<0.05). SEM, standard error of the mean.
ab-24-0691f1.jpg
Figure 2
Fisetin promoted the development of porcine in vitro fertilization (IVF) and somatic cell nuclear transfer (SCNT) embryos. (A, D) Representative images of porcine IVF and SCNT embryonic development at 48 h and day 6 (6 d) in the control and fisetin groups; scale bar = 500 μm. (B, C, E, F) 48 h cleavage rates and 6 d blastocyst formation rates of porcine IVF and SCNT embryos. (G, J) Representative blastocyst and fluorescence images of Hoechst33342-stained porcine IVF and SCNT blastocysts; scale bar = 50/500 μm. (H, I, K, L) Average diameter and total cell number in porcine IVF and SCNT blastocysts. The data are expressed as the mean±SEM of at least three independent experiments. Asterisks above the bars indicate significant differences from the control group (* p<0.05, ** p<0.01). SEM, standard error of the mean.
ab-24-0691f2.jpg
Figure 3
Fisetin increased the pluripotency of porcine parthenogenetic activation (PA) blastocysts. Relative expression of the pluripotency genes OCT4, NANOG, SOX2 and CDX2 in porcine PA blastocysts. The data are expressed as the mean±SEM of at least three independent experiments. Asterisks above the bars indicate significant differences from the control group (* p<0.05, ** p<0.01). SEM, standard error of the mean.
ab-24-0691f3.jpg
Figure 4
Fisetin increased cell proliferation and decreased apoptosis in porcine parthenogenetic activation (PA) blastocysts. (A, C) Representative images of EdU-positive cells and TUNEL-positive cells detected in porcine PA blastocysts; scale bar = 50 μm. (B, D) Percentage of EdU-positive cells and the apoptosis rate in porcine PA blastocysts. (E–G) Relative expression of BAX, BCL2 and BCL2/BAX mRNA. (H–J) Relative protein expression of BAX, BCL2 and BCL2/BAX. The data are expressed as the mean±SEM of at least three independent experiments. Asterisks above the bars indicate significant differences from the control group (* p<0.05, ** p<0.01, *** p<0.001). SEM, standard error of the mean.
ab-24-0691f4.jpg
Figure 5
Fisetin increased the antioxidant capacity and mitochondrial function in porcine parthenogenetic activation (PA) embryos. (A, D, G) Representative fluorescence images of 4 cell and blastocyst 2′,7′-DCFH, 4-CMF2HC and MitoTracker Red CMXRos staining of porcine PA embryos; scale bar = 100/200 μm. (B, C, E, F, H–K) Intracellular relative reactive oxygen species (ROS), glutathione (GSH), Mitochondrial membrane potential (MMP) and Adenosine triphosphate (ATP) levels during the 4 cell and blastocyst stages in porcine PA embryos. The data are expressed as the mean±SEM of at least three independent experiments. Asterisks above the bars indicate significant differences from the control group (** p<0.01, *** p<0.001). SEM, standard error of the mean.
ab-24-0691f5.jpg
Figure 6
Fisetin activates the NRF2-ARE signalling pathway. (A) The molecular docking of fisetin with the KEAP1 protein can be viewed as follows: the colourful protein is KEAP1, the small grey molecule is fisetin, and the small blue molecule is an amino acid residue in the protein that forms an interaction with fisetin. The force binding mode represented by the green dashed line is conventional hydrogen bonding. (B) Representative immunofluorescence images of KEAP1, NRF2, Hoechst33342 and Merge of NRF2+Hoechst33342 of porcine PA blastocysts; scale bar =50 μm. (C) Quantification of the fluorescence intensity of the NRF2 and KEAP1 proteins in porcine PA blastocysts. (D) Relative mRNA expression of NRF2 and KEAP1 in porcine PA blastocysts. (E) Relative protein expression of the antioxidant-related enzymes HO-1, SOD1, CAT and GPX4 in porcine PA blastocysts. The data are expressed as the mean±SEM of at least three independent experiments. Asterisks above the bars indicate significant differences from the control group (* p<0.05, ** p<0.01, *** p<0.001). HO-1, haem oxygenase 1; SOD1, superoxide dismutase 1; CAT, catalase; GPX4, glutathione peroxidase 4; SEM, standard error of the mean.
ab-24-0691f6.jpg
Figure 7
This schematic shows that fisetin promotes the expression of phase II antioxidant enzymes by interfering with the protein of KEAP1, causing the NRF2 protein to dissociate from it, increasing NRF2 levels and binding to AREs in the nucleus. Subsequently, mitochondrial function is improved, and cell proliferation capacity and pluripotency are enhanced, along with reduced apoptosis, thereby promoting porcine early embryonic development. AREs, antioxidant response elements; HO-1, haem oxygenase 1; NQO1, NAD(P)H quinone dehydrogenase 1; CAT, catalase; SOD, superoxide dismutase; GPX4, glutathione peroxidase 4; GSH, glutathione; ROS, reactive oxygen species; MMP, mitochondrial membrane potential; ATP, adenosine.
ab-24-0691f7.jpg
Table 1
Primer sequences for qPCR
Gene Forwards (5′–3′) Reverse (5′–3′) Gene Bank
BAX GCTTCAGGGTTTCATCCA TGTCCAGTTCATCTCCAAT XM_003127290.5
BCL2 GAACTGGGGGAGGATTGTGG CATCCCAGCCTCCGTTATC XM_021099593.1
CDX2 AGAACCGCAGAGCGAAGG AGAACCCCAGGGACAGAG NM_001278769.1
GAPDH TCGGAGTGAACGGATTTGGC TGACAAGCTTCCCGTTCTCC NM_001206359.1
GCLC GCCCAACCCCGTGGAAGA ACGCCCCAGCGACAATCA XM_021098556.1
GCLM GCACAGGTAAAACCAAACA GCTCTTAACAATGACCGAGT XM_001926378.4
NANOG AGCGAATCTTCACCAATG GCTTGTGGAAGAATCAGG NM_001129971.2
NQO1 CCAGCAGCCCGGCCAATCTG AGGTCCGACACGGCGACCTC NM_001159613.1
OCT4 GTGAGAGGCAACCTGGAGAG TCGTTGCGAATAGTCACTGC NM_001113060.1
SOX2 CGGCAACCAGAAGAACAG CTCCGTCTCCGACAAAAG NM_001123197.1

qPCR, quantitative real-time polymerase chain reaction.

Table 2
Antibodies for Western blot analysis
Antibody name Working concentration Catalog number Supplier
BAX 1: 1000 50599-2-Ig Proteintech
BCL2 1: 1000 68103-1-Ig Proteintech
CAT 1: 1000 66765-1-Ig Proteintech
GAPDH 1: 10000 60004-1-Ig Proteintech
GPX4 1: 1000 DF6701 Affinity
HO-1 1: 1000 10701-1-AP Proteintech
SOD1 1: 1000 67480-1-Ig Proteintech
Anti-mouse secondary antibody 1: 8000 SA00001-1 Proteintech
Anti-rabbit secondary antibody 1: 10000 SA00001-2 Proteintech

REFERENCES

1. van der Weijden VA, Schmidhauser M, Kurome M, et al. Transcriptome dynamics in early in vivo developing and in vitro produced porcine embryos. BMC Genomics 2021;22:139. https://doi.org/10.1186/s12864-021-07430-7
crossref pmid pmc
2. Agarwal A, Durairajanayagam D, du Plessis SS. Utility of antioxidants during assisted reproductive techniques: an evidence based review. Reprod Biol Endocrinol 2014;12:112. https://doi.org/10.1186/1477-7827-12-112
crossref pmid pmc
3. Wang CR, Ji HW, He SY, et al. Chrysoeriol improves in vitro porcine embryo development by reducing oxidative stress and autophagy. Vet Sci 2023;10:143. https://doi.org/10.3390/vetsci10020143
crossref pmid pmc
4. Ullah A, Munir S, Badshah SL, et al. Important flavonoids and their role as a therapeutic agent. Molecules 2020;25:5243. https://doi.org/10.3390/molecules25225243
crossref pmid pmc
5. Yang H, Hong Y, Gong M, et al. Fisetin exerts neuroprotective effects in vivo and in vitro by inhibiting ferroptosis and oxidative stress after traumatic brain injury. Front Pharmacol 2024;15:1480345. https://doi.org/10.3389/fphar.2024.1480345
crossref pmid pmc
6. Prem PN, Sivakumar B, Boovarahan SR, Kurian GA. Recent advances in potential of Fisetin in the management of myocardial ischemia-reperfusion injury-A systematic review. Phytomedicine 2022;101:154123. https://doi.org/10.1016/j.phymed.2022.154123
crossref pmid
7. Molagoda IMN, Jayasingha JACC, Choi YH, Jayasooriya RGPT, Kang CH, Kim GY. Fisetin inhibits lipopolysaccharide-induced inflammatory response by activating β-catenin, leading to a decrease in endotoxic shock. Sci Rep 2021;11:8377. https://doi.org/10.1038/s41598-021-87257-0
crossref pmid pmc
8. Markowska A, Antoszczak M, Kacprzak K, Markowska J, Huczyński A. Role of fisetin in selected malignant neoplasms in women. Nutrients 2023;15:4686. https://doi.org/10.3390/nu15214686
crossref pmid pmc
9. Tang X, Deng P, Jiang Y, Zhang L, He Y, Yang H. An overview of recent advances in the neuroprotective potentials of fisetin against diverse insults in neurological diseases and the underlying signaling pathways. Biomedicines 2023;11:2878. https://doi.org/10.3390/biomedicines11112878
crossref pmid pmc
10. Kang KA, Piao MJ, Kim KC, et al. Fisetin attenuates hydrogen peroxide-induced cell damage by scavenging reactive oxygen species and activating protective functions of cellular glutathione system. In Vitro Cell Dev Biol Anim 2014;50:66–74. https://doi.org/10.1007/s11626-013-9681-6
crossref pmid
11. Rodius S, de Klein N, Jeanty C, et al. Fisetin protects against cardiac cell death through reduction of ROS production and caspases activity. Sci Rep 2020;10:2896. https://doi.org/10.1038/s41598-020-59894-4
crossref pmid pmc
12. Zhang L, Wang H, Zhou Y, Zhu Y, Fei M. Fisetin alleviates oxidative stress after traumatic brain injury via the Nrf2-ARE pathway. Neurochem Int 2018;118:304–13. https://doi.org/10.1016/j.neuint.2018.05.011
crossref pmid
13. Chen Q, Gao L, Li J, et al. α-Ketoglutarate improves meiotic maturation of porcine oocytes and promotes the development of pa embryos, potentially by reducing oxidative stress through the Nrf2 pathway. Oxid Med Cell Longev 2022;2022:7113793. https://doi.org/10.1155/2022/7113793
crossref pmid pmc
14. Khadrawy O, Gebremedhn S, Salilew-Wondim D, et al. Quercetin supports bovine preimplantation embryo development under oxidative stress condition via activation of the Nrf2 signalling pathway. Reprod Domest Anim 2020;55:1275–85. https://doi.org/10.1111/rda.13688
crossref pmid
15. He F, Ru X, Wen T. NRF2, a transcription factor for stress response and beyond. Int J Mol Sci 2020;21:4777. https://doi.org/10.3390/ijms21134777
crossref pmid pmc
16. Dinkova-Kostova AT, Hakomäki H, Levonen AL. Electrophilic metabolites targeting the KEAP1/NRF2 partnership. Curr Opin Chem Biol 2024;78:102425. https://doi.org/10.1016/j.cbpa.2024.102425
crossref pmid
17. Madden SK, Itzhaki LS. Structural and mechanistic insights into the Keap1-Nrf2 system as a route to drug discovery. Biochim Biophys Acta Proteins Proteom 2020;1868:140405. https://doi.org/10.1016/j.bbapap.2020.140405
crossref pmid
18. Mylroie H, Dumont O, Bauer A, et al. PKCɛ-CREB-Nrf2 signalling induces HO-1 in the vascular endothelium and enhances resistance to inflammation and apoptosis. Cardiovasc Res 2015;106:509–19. https://doi.org/10.1093/cvr/cvv131
crossref pmid pmc
19. Li Q, Zheng Y, Zhao J, et al. Radish red attenuates chronic kidney disease in obese mice through repressing oxidative stress and ferroptosis via Nrf2 signaling improvement. Int Immunopharmacol 2024;143:113385. https://doi.org/10.1016/j.intimp.2024.113385
crossref pmid
20. Wang Y, Zhang Z, Du M, et al. Berberine alleviates ETEC-induced intestinal inflammation and oxidative stress damage by optimizing intestinal microbial composition in a weaned piglet model. Front Immunol 2024;15:1460127. https://doi.org/10.3389/fimmu.2024.1460127
crossref pmid pmc
21. Wang C, Chen S, Guo H, et al. Forsythoside a mitigates alzheimer’s-like pathology by inhibiting ferroptosis-mediated neuroinflammation via Nrf2/GPX4 axis activation. Int J Biol Sci 2022;18:2075–90. https://doi.org/10.7150/ijbs.69714
crossref pmid pmc
22. Liang S, Jin YX, Yuan B, Zhang JB, Kim NH. Melatonin enhances the developmental competence of porcine somatic cell nuclear transfer embryos by preventing DNA damage induced by oxidative stress. Sci Rep 2017;7:11114. https://doi.org/10.1038/s41598-017-11161-9
crossref pmid pmc
23. Qi JJ, Li XX, Zhang Y, et al. Supplementation with asiatic acid during in vitro maturation improves porcine oocyte developmental competence by regulating oxidative stress. Theriogenology 2021;172:169–77. https://doi.org/10.1016/j.theriogenology.2021.06.013
crossref pmid
24. Cai W, Wu J, Sun Y, et al. Synthesis, evaluation, molecular dynamics simulation and targets identification of novel pyrazole-containing imide derivatives. J Biomol Struct Dyn 2021;39:2176–88. https://doi.org/10.1080/07391102.2020.1745284
crossref pmid
25. Ali MZ, Dholaniya PS. Oxidative phosphorylation mediated pathogenesis of Parkinson’s disease and its implication via Akt signaling. Neurochem Int 2022;157:105344. https://doi.org/10.1016/j.neuint.2022.105344
crossref pmid
26. Rodrigues T, Ferraz LS. Therapeutic potential of targeting mitochondrial dynamics in cancer. Biochem Pharmacol 2020;182:114282. https://doi.org/10.1016/j.bcp.2020.114282
crossref pmid
27. Podolak A, Woclawek-Potocka I, Lukaszuk K. The role of mitochondria in human fertility and early embryo development: what can we learn for clinical application of assessing and improving mitochondrial DNA? Cells 2022;11:797. https://doi.org/10.3390/cells11050797
crossref pmid pmc
28. Deluao JC, Winstanley Y, Robker RL, Pacella-Ince L, Gonzalez MB, McPherson NO. Oxidative stress and reproductive function: reactive oxygen species in the mammalian pre-implantation embryo. Reproduction 2022;164:F95–108. https://doi.org/10.1530/REP-22-0121
crossref pmid
29. Joo YE, Jeong PS, Lee S, et al. Anethole improves the developmental competence of porcine embryos by reducing oxidative stress via the sonic hedgehog signaling pathway. J Anim Sci Biotechnol 2023;14:32. https://doi.org/10.1186/s40104-022-00824-x
crossref pmid pmc
30. Xing X, Liang Y, Li Y, et al. Fisetin delays postovulatory oocyte aging by regulating oxidative stress and mitochondrial function through Sirt1 pathway. Molecules 2023;28:5533. https://doi.org/10.3390/molecules28145533
crossref pmid pmc
31. Piao MJ, Kim KC, Chae S, Keum YS, Kim HS, Hyun JW. Protective effect of fisetin (3,7,3’,4’-Tetrahydroxyflavone) against gamma-irradiation-induced oxidative stress and cell damage. Biomol Ther 2013;21:210–5. https://doi.org/10.4062/biomolther.2013.017
crossref
32. Molagoda IMN, Athapaththu AMGK, Choi YH, et al. Fisetin inhibits NLRP3 inflammasome by suppressing TLR4/MD2-mediated mitochondrial ros production. Antioxidants 2021;10:1215. https://doi.org/10.3390/antiox10081215
crossref pmid pmc
33. Li D, Liu X, Pi W, et al. Fisetin attenuates doxorubicin-induced cardiomyopathy in vivo and in vitro by inhibiting ferroptosis through SIRT1/Nrf2 signaling pathway activation. Front Pharmacol 2022;12:808480. https://doi.org/10.3389/fphar.2021.808480
crossref pmid pmc
34. Jiang K, Yang J, Xue G, Dai A, Wu H. Fisetin ameliorates the inflammation and oxidative stress in lipopolysaccharide-induced endometritis. J Inflamm Res 2021;14:2963–78. https://doi.org/10.2147/JIR.S314130
crossref pmid pmc
35. Lu L, Huang X, Shi Y, Jiang Y, Han Y, Zhang Y. Mitochondrial dysfunction in pregnancy loss: a review. Mol Cell Biochem Forthcoming 2024;https://doi.org/10.1007/s11010-024-05171-1
crossref
36. Shah SZA, Zhao D, Hussain T, Sabir N, Mangi MH, Yang L. p62-Keap1-NRF2-ARE Pathway: a contentious player for selective targeting of autophagy, oxidative stress and mitochondrial dysfunction in prion diseases. Front Mol Neurosci 2018;11:310. https://doi.org/10.3389/fnmol.2018.00310
crossref pmid pmc
37. Chang PR, Liou JW, Chen PY, et al. The neuroprotective effects of flavonoid fisetin against corticosterone-induced cell death through modulation of ERK, p38, and PI3K/Akt/FOXO3a-dependent pathways in PC12 cells. Pharmaceutics 2023;15:2376. https://doi.org/10.3390/pharmaceutics15102376
crossref pmid pmc
38. Glanzner WG, da Silva Sousa LR, Gutierrez K, et al. NRF2 attenuation aggravates detrimental consequences of metabolic stress on cultured porcine parthenote embryos. Sci Rep 2024;14:2973. https://doi.org/10.1038/s41598-024-53480-8
crossref pmid pmc
39. Jeon SB, Jeong PS, Kim MJ, et al. Enhancement of porcine in vitro embryonic development through luteolin-mediated activation of the Nrf2/Keap1 signaling pathway. J Anim Sci Biotechnol 2023;14:148. https://doi.org/10.1186/s40104-023-00947-9
crossref pmid pmc
40. Li YM, Chung YL, Wu YF, Wang CK, Chen CM, Chen YH. Maternal exposure to hyperbaric oxygen at the preimplantation stages increases apoptosis and ectopic Cdx2 expression and decreases Oct4 expression in mouse blastocysts via Nrf2-Notch1 upregulation and Nf2 downregulation. Dev Dyn 2024;253:467–89. https://doi.org/10.1002/dvdy.671
crossref pmid
TOOLS
METRICS Graph View
  • 2 Web of Science
  • 3 Crossref
  • 2 Scopus
  • 3,133 View
  • 138 Download
Related articles


Editorial Office
Asian-Australasian Association of Animal Production Societies(AAAP)
Room 708 Sammo Sporex, 23, Sillim-ro 59-gil, Gwanak-gu, Seoul 08776, Korea   
TEL : +82-2-888-6558    FAX : +82-2-888-6559   
E-mail : editor@animbiosci.org               

Copyright © 2026 by Asian-Australasian Association of Animal Production Societies.

Developed in M2PI

Close layer
prev next