All animal procedures used in this study were approved by the Institutional Animal Care and Use Committee, Southwest Minzu University (permit number: S2020-013, revised on 1 June 2004). Goat primary intramuscular preadipocytes were isolated using the previously described method with minor modification [28]. Briefly, the longissimus dorsi muscle tissues were collected from two-day-old Jianzhou goats from Jianyang County (Sichuan, China) after slaughter. The tissues were then washed 3 times with phosphate-buffered saline (PBS), separated and trimmed on a super clean bench, following which 2 volumes of type II Collagenase (Sigma, St. Louis, MO, USA) was supplemented for digestion at 37°C for 90 min (shaking every 5 min). The digestion was stopped by adding an equal volume of complete culture medium containing 10% fetal bovine serum (DMEM/F12 containing 10% FBS, 1% antibiotic, and 50 μmol/L oleic acids [Sigma, Tokyo, Japan]). The samples were then filtered using sterile gauze and a 75-μm cell strainer, and the cells were then centrifuged at 2,000 r/min for 5 min. After discarding the supernatant, the red blood cell lysate was used for resuspended the cells, followed by standing for 5 min and centrifuging at 2,000 r/min for 5 min. After resuspending in clear complete culture medium, the cells were seeded into 25 cm² culture flasks for the following cultivation under 5% CO₂ at 37°C with new complete medium after 2 h. The cell culture medium was changed every two days until the cell density reached 80%. For cell treatment, the cells were passed to the third generation at a ratio of 1 to 3 and inoculated into 6-well plate (10-cm²). After treatment was completed, the cell culture medium was replaced with an adipocyte-inducing medium.

The plasmid of pMD19-T-CIDEB was stored in our laboratory. A subcloning system was preformed to amplify the target sequences after added the protective base, Hind III and myc-tagged and BamHI to the primers. The primers as follows: S: CCCAAGCTTATGGAGCAGAAACTCATCTCTGAAGAGGATCTGGAGTACCTCTCTAACCTGGAC, A: CGCGGATCCTCAGTAGGGTTTAAGGCGACCCTG.

Subcloning conditions as follows: 98°C for 3 min; 98°C for 15 s, 57°C for 30 s, 72°C for 2 min, 30 cycles; 72°C for 10 min. The polymerase chain reaction (PCR) product was then recycled and digested and linked to digested pcDNA3.1 to build pcDNA3.1-CIDEB recombination plasmid. After being transformed into competent cells DH5α (Tsingke, Beijing, China) and identified by double digestion, the plasmid was validated by DNA sequencing with the help of Chengdu Tsingke biotechnology company.

Negative control (NC) siRNA and two siRNAs of goat CIDEB gene were synthesized by Shanghai GenePharma company. siRNA-NC: S: UUCUCCGAACGUGUCACGUTT, A: ACGUGACACGUUCGGAGAATT. siRNA-CIDEB165: S: GUCAGGAACUGCUAGACAATT, A: UUGUCUAGCAGUUCCUGACTT. siRNA-CIDEB396: S: GCAUCACCUUCGACGUAUATT, A: UAUACGUCGAAGGUGAUGCTT.

Cell transfection was performed as previously described [29]. After cell passage, transfection was performed with Lipofectamine 3000 (Thermo Fisher Scientific, Shanghai, China) when the cells filled 70% to 80% of the culture vial. They were transfected with pcDNA3.1-CIDEB, pcDNA3.1, siRNA-CIDEB165 and NC siRNA. In this experiment, pcDNA3.1-CIDEB plasmid group and siRNA-CIDEB (si-CIDEB) group were the experimental group, and pcDNA3.1 plasmid (NC) group and negative control siRNA (si-NC) group were the control group. First, the cells are starved; After the medium was discarded and washed three times with PBS, 900 μL Opti medium was added to each well of the six-well plate and placed in a constant temperature incubator at 37°C for 4 hours. After starvation treatment, the transfection premix was prepared: In the overexpression experiment, the premix was 50 μL Opti medium and 3 μL lip3000. Premixed solution B consists of 50 μL Opti medium mixed with 2.5 μL P3000 and 1μg plasmid DNA (pcDNA3.1-CIDEB or pcDNA3.1). Mix the premix well and let it sit at room temperature for 20 minutes before using. Interference assay: 100 μL Opti medium, 6 μL lip3000, and 4 μL siRNA were mixed, and the premix was also placed at room temperature for 10 minutes, then gently suspended and instillated to complete cell transfection for overexpression and interference studies. Six hours after transfection, 50 μmol/L Sigma oleic acid induction solution was added, and cells were collected after 48 hours of culture.

Oil red O staining was performed as the previously reported methods [30]. Briefly, the cells were slowly washed 3 times with PBS and fixed with 10% formaldehyde for 30 min. After discarding the formaldehyde and washing the cells 3 times with PBS, Oil Red O working solution (the mixture of 3 mL Oil Red 5 g/L dissolved in isopropanol and 2 mL of ddH₂O) was supplemented for 20 min incubation at room temperature. Finally, the cells were cleaned with PBS and photographed with inverted fluorescence microscope (Zeiss, Tokyo, Japan). For the quantification of Oil Red O, 1 mL of isopropanol was added to each well of the 6-well plate and the absorbance value at 510 nm was measured using a spectrophotometer (Thermo Fisher Scientific, Shanghai, China).

Cellular triglyceride content in goat intramuscular adipocytes were used to determine Tissue Triglyceride Content Assay Kit (Applygen, Beijing, China). Briefly, the cells were washed three times with PBS, and treated by 200 μL of triglyceride lysate on ice for 10 min. Then the lysate was divided into two portions for optical density value assay, one for triglyceride detection at 562 nm while the other one for cellular total protein detection by bicinchoninic acid assay at 550 nm according to the manual of the kit (Vazyme, Nanjing, China), which was then used for triglyceride content correction.

After the treatment of overexpression and siRNA silencing of CIDEB for 48h, the cells were harvested and treated by 1 mL Trizol (Takara, Dalian, China) for total RNA extraction. The RNA transcriptome sequencing was performed by Shanghai OE Biotechnology Co, Ltd. Gene Ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) analysis were analyzed using oebiotech (https://www.oebiotech.com/index.php?c=show&id=414). All the experiments were replicated three times.

To further explore the mechanism of CIDEB in lipid metabolism, its overexpression and interference were used to detect the effect on the expression of genes related to lipid metabolism. The primers of quantitative real-time PCR (RT-qPCR) are shown in Table 1. Real-time quantitative PCR was performed using three biological replicates and technical triplicates of each cDNA sample, according to the manufacturer’s protocol. Relative expression levels of target genes for gene correction using ubiquitously expressed transcript (UXT) as an internal reference. PCR was performed using the same volume of cDNA sample for each gene to record the cycle threshold (Ct) value. PCR experiments were performed with a Bio-Rad CFX96 PCR System using Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Q712-02). PCR reaction system 10 μL, including 5 μL SYBR Green Real-time PCR Master Mix (Vazyme), 0.2 L (10 μM) primers, 1 μL sample and 3.6 μL ddH₂O. The following cycling conditions were used: 95°C for 3 min to activate the polymerase followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 30 s and extension at 72°C for 30 s. Fluorescence signal was obtained at a temperature of 72°C extension.

RT-qPCR results were statistically analyzed by 2^−ΔΔCt method. All test data were set with at least 3 biological replicates. GraphPad Prism 9.0 was used for statistical analysis and plotting. Two-tailed t-test was used for significance identification.

To further elucidate the role of CIDEB in fat deposition, we ligated the CDS region of the CIDEB gene into vector, obtained 5428 bp (pcDNA3.1 vector) and 708 bp (CIDEB gene) by Hind III and Bam HI restriction enzymes digestion and transfected them into goat intramuscular precursor adipocytes. The expression level of CIDEB was increased by about 230-fold compared with the control after overexpression of CIDEB (Figure 1A). The cellular triglyceride was increased significantly by 1.62-fold after overexpression of CIDEB compared with control (Figure 1B). Consistent with the results of triglyceride formation, the accumulation of lipid droplets in cells also increased by 1.39-fold compared with control (Figure 1C). Meanwhile, the overexpression of CIDEB also significantly increased the expression of adipose differentiation marker genes peroxisome proliferator activated receptor gamma (PPARγ) by 1.57-fold and enhancer binding protein alpha (C/EBPα) by 1.67-fold (Figure 2A), lipid droplet accumulation-related genes perilipin 1 (PLIN1) by 33.82-fold and tail-interacting protein 47 (TIP47) by 5.07-fold (Figure 2B), fatty acid synthesis and transport genes acetyl-CoA carboxylase (ACC) by 2.48-fold, acyl-CoA synthetase long-chain family member 1 (ACSL1) by 1.64-fold, fatty acid binding protein 3 (FABP3) by 1.74-fold and fatty acid synthase (FASN) by 1.18-fold (Figure 2D), triglyceride synthesis-related gene diacylglycerol O-acyltransferase 2 (DGAT2) by 1.16-fold (Figure 2C). Correspondingly, the overexpression of CIDEB significantly decreased the expression of lipolysis and fatty acid β oxidation-related genes acyl-CoA oxidase 1 (ACOX1) by 50% and hormone-sensitive lipase (HSL) by 58% (Figure 2E). In conclusion, it can be considered that overexpression of CIDEB promotes adipogenesis in goat intramuscular preadipocytes.

To determine the possible mechanism underlying the activated lipid deposition, RNA-Seq analysis was performed after CIDEB overexpression in goat intramuscular preadipocytes. In results, a total of 171 differentially expressed genes (DEGs) were screened (p<0.05) by the overexpression of CIDEB, including 122 up-regulated genes and 49 down-regulated genes (Figures 3A, 3B). GO enrichment analysis showed that the upregulated DEGs were related to cytosol, membrane-enclosed lumen, organelle lumen, intracellular organelle lumen, nuclear lumen and protein maturation (Figure 3C); the downregulated DEGs were related to organelle membrane, ER, mitochondrial membrane, quinone or similar compound as acceptor, mitochondrial inner membrane and organelle inner membrane (Figure 3D). By GO analysis, the DEGs were enriched in 21 terms of biological processes (mainly containing cellular processes, metabolic processes, biological regulation, biological process regulation and stimulus response), 8 terms of molecular functions (mainly containing binding and catalytic activities) and 17 terms of cellular components (mainly containing cells, cellular structural material, organelles, membrane and organellar structural material) (Figure 3E). Three lipid metabolism-related pathways were screened from the functional annotation results of GO, respectively aminophospholipid transport, lipid metabolic process, and glycerolipid metabolic process (p<0.05) (Table 2). To probe the potential signal pathways by CIDEB overexpression, the up- and down-regulated DEGs were analyzed by KEGG analysis respectively. For the up-regulated DEGs, malaria, taurine and hypotaurine metabolism, amphetamine addiction and cocaine addiction were enhanced (Figure 3F). In addition, we verified their expression levels through RT-qPCR analysis. Consistently, overexpression of CIDEB downregulated the expression of FASN and ACSL1 (Figure 4).

To elucidate the role of CIDEB in regulating intramuscular lipid accumulation in goats, we silenced the expression of CIDEB by two pairs of siRNAs in goat intramuscular preadipocytes. The expression level of CIDEB was reduced by 82% with treatment of CIDEB-165 and 75% with the treatment of CIDEB-396 (Figure 5A), so CIDEB-165 was used in the subsequent experiment. Contrary to overexpression, the abundance of TAG decreased by 28% after CIDEB knockdown (Figure 5B), and the accumulation of lipid droplets decreased significantly by 27% (Figure 5C). The knockdown of CIDEB significantly decreased the expression of PPARγ by 42%, LPL by 35%, C/EBPα by 69%, SREBP1 by 62% (Figure 6A), PLIN1 by 31%, TIP47 by 84% (Figure 6B), ACC by 62%, FASN by 80%, ACSL1 by 78% and FABP3 by 14% (Figure 6D), and meanwhile up-regulated the expression of ATGL (1.29-fold), CPT1B (1.28-fold), ACOX1 (7.92-fold) and CPT1A (1.29-fold) (Figure 6E) by CIDEB interference. In conclusion, it can be launched to conclude that interfering of CIDEB inhibited lipid deposition in goat intramuscular preadipocytes.

To determine the possible mechanism underlying the inactivated lipid deposition, RNA-Seq analysis was performed after CIDEB silencing in goat muscle preadipocytes. A total of 2140 DEGs were screened (p<0.05), including 1252 up-regulated genes and 888 down-regulated genes (Figures 7A, 7B). GO enrichment analysis showed that the upregulated DEGs were related to intracellular anatomical structure, organelle, intracellular organelle, membrane-bounded organelle, cytoplasm and intracellular membrane-bounded organelle (Figure 5C); the downregulated DEGs were related to intracellular anatomical structure, intracellular organelle, organelle, cellular protein metabolic process, cytoplasm, non-membrane-bounded organelle, intracellular non-membrane-bounded organelle (Figure 5D). By GO analysis, the DEGs were enriched in 25 terms of biological processes (mainly containing metabolic processes, developmental process, rhythmic process, reproductive process, multi-organism processes, locomotion and growth response), 8 terms of molecular functions (mainly containing binding and catalytic activities) and 17 terms of cellular components (mainly containing organelle part, membrane-enclosed lumen, nucleoid, extracellular region part and extracellular matrix component) (Figure 7E). Four lipid metabolism-related pathways were screened from the functional annotation results of GO, respectively lipid transport involved in lipid storage, lipid storage, aminophospholipid transport and cellular response to lipid (p<0.05) (Table 3). To probe the potential signal pathways by CIDEB interference, the up- and down-regulated DEGs were analyzed by KEGG analysis respectively. For the up-regulated DEGs, apelin signaling pathway, insulin signaling pathway, glycolysis/gluconeogenesis and focal adhesion were enhanced (Figure 7F). In addition, we verified their expression levels through RT-qPCR analysis. Consistently, interference with CIDEB downregulated expression of FASN and ACSL1 (Figure 4).