Go to Top Go to Bottom
Anim Biosci > Volume 38(5); 2025 > Article
Li, Hu, Li, Li, Lin, Wang, Liu, and Wang: Effect of gene CRTC2 on the differentiation of subcutaneous precursor adipocytes in goats

Abstract

Objective

The aim of this study was to obtain goat CRTC2 gene sequence and elucidate its biological properties, and further study the impact of overexpression and interference of CRTC2 on the cell differentiation of goat subcutaneous precursor adipocytes.

Methods

The sequence of goat CRTC2 was cloned by reverse transcription (RT)-polymerase chain reaction (PCR) and its molecular characterization was analyzed. The expression of CRTC2 gene in goat tissues and subcutaneous precursor adipocytes differentiated from 0 to 120 h was examined by quantitative real-time PCR (qRT-PCR). The effects of CRTC2 on the subcutaneous precursor adipocyte differentiation were investigated by using liposome transfection, Bodipy, Oil Red O staining and qPCR.

Results

The results showed that the cloned goat CRTC2 gene was 2363 bp long (coding sequence [CDS] 2082 bp), encoding 693 amino acids. The relative expression levels of CRTC2 gene were highest in liver and then in kidney (p<0.05). During differentiation, the highest expression of CRTC2 in subcutaneous precursor adipocytes was observed at 120 of differentiating (p<0.01). In addition, we found that overexpression of CRTC2 significantly increased the expression of lipid metabolism-related genes (C/EBPα, C/EBPβ, PPARγ, DGAT1, DGAT2, ACC, FASN, SREBP1, AP2, LPL, ATGL) and promoted lipid accumulation. We then chemically synthesized goat CRTC2 small interfering RNA and transfected it into goat subcutaneous precursor adipocytes. The results revealed that SiRNA-mediated interference with CRTC2 significantly inhibited its differentiation and suppressed lipid droplet aggregation.

Conclusion

So, this study indicates that CRTC2 is a positive regulator that promoting cell differentiation of subcutaneous adipocyte in goats, which lays the foundation for an in-depth study of the role of CRTC2 in lipid deposition in goats.

INTRODUCTION

Adipose tissue is an active endocrine organ that involved in a variety of activities such as insulin sensitivity, glucose tolerance, lipid metabolism and deposition [1,2]. It has been found that adipose is distributed throughout the body of goat, including subcutaneous, visceral, intramuscular, intermuscular and caudal. Subcutaneous adipose tissue is the most widely distributed adipose and is closely related to carcass characteristics such as intramuscular fat content, tenderness, and flavor [35]. Similar to the role of intermuscular and intramuscular fat in meat characteristics, subcutaneous adipose tissue affects the texture, flavor and nutritional value of edible meat [6]. Therefore, it is important to reveal the metabolic characteristics and regulatory mechanisms of subcutaneous fat development.
CREB-regulated transcriptional co-activators (CRTCs) are a class of transcriptional co-activators that promote the transcriptional activity of basic leucine zipper-type transcription factors, including CREBs [7,8]. There are three family members of CRTCs, including CRTC1, CRTC2, and CRTC3. Prior studies have shown that CRTC1 is expressed predominantly in the brain and is involved in brain synaptic plasticity, learning, long-term memory formation and mitochondrial metabolic activities [9]. CRTC3 is highly expressed in adipose tissue and plays an important role in insulin resistance and energy metabolism [10]. Differently, CRTC2 is widely expressed in most peripheral tissues, such as muscle [11] and liver [12]. It has been suggested that CRTC2 is responsible for the transcriptional regulation of hepatic gluconeogenesis [13], and the role of CRTC2 in hepatic lipid metabolism has recently been elucidated [14]. In addition to its role as a transcriptional co-activator, CRTC2 has been shown to interact with the coat protein complex II subunit protein Sec31A to inhibit sterol regulatory element-binding protein-1 (SREBP1) mediated lipogenesis in the liver [15]. Besides, induction of cholesterol synthesis was observed through CRTC2/FOXO1-mediated transcriptional activation of SREBP2 [16], suggesting that CRTC2 is a key protein in the regulation of hepatic glucose and lipid metabolism. Hepatic-specific CRTC2 was found to have no significant changes in hepatic lipid metabolism in normal diet-fed mice, but metabolic homeostasis was altered in hepatic CRTC2-deficient high-fat diet mice [17]. Currently, it has been shown that this gene plays an important role in many physiological activities such as lipid metabolism in Nile tilapia [18], rat [19], and cattle [20]. However, the effect of CRTC2 gene on subcutaneous precursor adipocyte differentiation and lipid metabolism in goats is still unclear.
This study intends to investigate the effect of CRTC2 on adipogenesis in subcutaneous precursor adipocytes of Jianzhou Daer goats. First, we cloned the sequence of goat CRTC2 gene by using reverse transcription (RT)-polymerase chain reaction (PCR) technology, and carried out bioinformatics analysis, then we used real-time fluorescence quantitative PCR (qPCR) technology to study its expression level in various tissues of the goat, and constructed tissue expression profiles and cellular temporal expression profiles, and further investigated the effects of overexpression and interference of CRTC2 on the differentiation of goat subcutaneous precursor adipocytes was further investigated by overexpression and interference. The results of this study will provide important basic data for the final elucidation of the mechanism of CRTC2 regulation of subcutaneous precursor adipocyte differentiation in goats, and provide a new strategy for molecular breeding of goats.

MATERIALS AND METHODS

Sample collection

All animal experiments were reviewed by Animal Experimental Ethical Inspection of Southwest University for Nationalities (No.2020086). In this experiment, seven-day-old Jianzhou Daer goats (n = 3) were purchased from Sichuan Tiandi Goat Biological Engineering Co., Ltd. (Chengdu, China). After slaughter, heart, liver, spleen, lung, kidney, week of kidney fat, longissimus dorsi muscle and small intestine tissue samples were collected. Then were washed with phosphate buffered saline (PBS), wrapped in tin foil and placed in cryopreservation tubes. Samples were immediately frozen in liquid nitrogen for later analysis.

Cell isolating and culturing

The primary cells for this experiment were obtained from subcutaneous adipocytes of 7-day-old Jianzhou Daer goats and were preserved in liquid nitrogen in the laboratory. Goat subcutaneous preadipocytes isolation and culture methods were in accordance with previously described methods [21]. Briefly, subcutaneous adipose tissue was isolated from healthy 7-day-old Jianzhou Daer goats under aseptic conditions, and connective tissue and blood vessels were removed. After rinsing 2 to 3 times with antibiotic-containing PBS, the subcutaneous adipose tissue of the goats was cut with scissors and digested with type I collagenase (Sigma, Shanghai, China) for 1 h at 37°C. The cell suspension was then centrifuged again at 1,500 r·min−1 for 5 min and the cells were removed from the cells. The cell suspension was then centrifuged again at 1,500 r·min−1 for 5 min, and the preadipocytes were resuspended in Dulbecco’s modified essential medium (DMEM)/F12 (Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (FBS) (Gemini, Calabasas, CA, USA) and 1% penicillin-streptomycin (Gemini). Finally, the cell suspension was transferred to cell culture flasks and cultured in an incubator at 37°C and 5% CO2 to obtain primary subcutaneous adipocytes.

Cloning of goat CRTC2 gene

Based on the predicted sequence of goat CRTC2 (GeneID: 102180907) on NCBI, primers were designed using Primer Premier 5.0 software (Table 1) and synthesized by Beijing Qingke Biotechnology Co., Ltd. the PCR reaction system consisted of 25 μL of Primer STAR Max DNA Polymerase (TaKaRa, Tokyo, Japan). The PCR reaction system consisted of 25 μL of Primer STAR Max DNA Polymerase, 2.0 μL (10 μmol L−1) of positive and negative primers, 2.0 μL of goat small intestine cDNA and 19 μL of ddH2O. The reaction conditions were as follows: PCR amplification program: pre-denaturation (98°C, 2 min); denaturation (98°C, 10 s), annealing (60°C, 15 s), extension (72°C, 45 s), 35 cycles; extension (72°C, 2 min), 4°C holding. Amplification products were recovered by agarose gel electrophoresis and ligated with 007 VS cloning vector (Qingke, Beijing, China) for 5 min at 25°C in a metal bath and transformed into E. coli DH5α competent cells (Qingke). DH5α competent cells, take appropriate amount of bacterial solution and apply it to the plate containing ampicillin (Biosharp, Shanghai, China), place it in 37°C constant temperature incubator and incubate overnight, pick the monoclonal colonies to expand the culture for 10 h, and then send the bacterial solution (at least 3 tubes) identified as positive by PCR to Qingke Bio-technology for sequencing. Bioinformatics analyses are shown in Table 2.

Vectors construction, chemical synthesis of siRNA, and transfection

EcoR I and Xho I (TaKaRa) cleavage sites were selected and the goat CRTC2 expression vector was constructed by double cleavage. The pEGFP-N1 plasmid and the subcloned products were double digested separately to purify the fragments. The fragments were ligated with T4 ligase (TaKaRa) at 16°C overnight. After confirmation of digestion, the fragments were transformed into DH5α to screen positive colonies for sequencing. The correctly sequenced bacterial fluids were amplified and the plasmids extracted (Supplement 1). In RNA interference experiments, Gene Pharma (Shanghai, China) designed and synthesized SiRNA targeting CRTC2 (named Si-CRTC2) and negative control SiRNA (named Si-NC). All transfection experiments were performed using TurboFect (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. For example, 6-well plates were transfected with 2 μg of plasmid DNA per well at 70% to 80% cell confluence. To silence CRTC2, 2 μg of Si-CRTC2 or Si-NC was used in each well. The solution was changed after 16 h and cells were collected for subsequent experiments after 48 h of incubation.

Induced differentiation of goat subcutaneous preadipocytes

For differentiation of goat subcutaneous preadipocytes, culture goat subcutaneous preadipocytes in DMEM/F12 cell culture medium (containing 10% fetal bovine serum and 1% antibiotics). For example, third-generation goat subcutaneous preadipocytes were inoculated into 6-well plates with 8×104 cells per well. After 16 h of transfection, the cells were cultured in adipocyte induction medium (DMEM/F12 with 10% FBS, 1% antibiotics and 50 μmol L−1 oleic acid (Sigma-Aldrich, St. Louis, MO, USA) for 48 h.

Oil Red O staining, Bodipy staining and 4′,6-diamidino-2-phenylindole staining

Cells for staining were grown in 24-well plates. The transfection system corresponded to half of a 12-well plate. After 48 h of induction, the medium was discarded, washed three times with PBS and fixed with 4% paraformaldehyde for 30 min at room temperature. For Oil Red O staining, 200 μL of Oil Red O working solution (Oil Red O stock solution : ddH2O = 3:2) (Solarbio, Beijing, China) was added to each well and the red lipid droplets were observed after 30 min of staining. After staining and washing, the cells were observed and photographed using an Olympus IX-73 fluorescence microscope (Olympus, Tokyo, Japan). For quantification of Oil Red O, 1 mL of 100% isopropanol was added to each well to extract the dye. The absorbance of the extracted dye at 490 nm was then detected using an enzyme marker.
Bodipy and 4′,6-diamidino-2-phenylindole (DAPI) staining were performed. Cells were washed three times with PBS, and then Bodipy working solution (Bodipy stock solution : PBS = 1:1,000, 200 μL per well) purchased from Thermo Fisher Scientific was added to each well of the plate under the condition of avoiding light, and the staining was avoided from light for 10 min, then washed with PBS, and DAPI (DAPI stock solution : PBS = 1:1,000) dye was added for 10 min. DAPI (DAPI stock solution : PBS = 1:1,000, 200 μL per well) was added to each plate well, and then washed with PBS after 10 min of light-avoidance staining. Finally, the aggregation of lipid droplets in adipocytes was observed under a fluorescence microscope and photographed.

RNA isolation and quantitative reverse transcription polymerase chain reaction analysis

Extract total RNA from goat tissues using the Trizol reagent (TaKaRa) method, and reverse transcribe the RNA into cDNA using the Revert Aid MM kit (Thermo Fisher Scientific). The ubiquitin-expressing transcript (UXT) gene was individually selected as an internal reference gene to normalize mRNA levels. The relative expression level of CRTC2 gene in subcutaneous adipocytes was detected by qPCR technique. Relative expression levels of CRTC2 gene in subcutaneous adipocytes. The relative expression levels of CRTC2 gene in subcutaneous adipocytes at different different differentiation times (0, 12, 24, 36, 48, 60, 72, 84, 96, 108, 120 h). Total PCR system 20 μL (premix 2× TBG 10 μL, ddH2O 6 μL, upstream 1 μL, downstream 1 μL and cDNA 2 μL). PCR process 40 cycles of pre-denaturation at 95°C for 3 min, denaturation at 94°C for 10 sec, annealing at 60°C for 20 sec and extension at 72°C for 30 sec. When detecting the effects of overexpression of CRTC2 and Si-CRTC2 on the differentiation of subcutaneous adipocytes in goats, adipogenic genes (peroxisome proliferator-activated receptor γ [PPARγ], CAAT enhancer binding protein α [C/EBPα], CAAT enhancer binding protein β [C/EBPβ], triglycerides (TG) synthesis genes (diacylglycerol acyltransferase 1 [DGAT1], DGAT2, acetyl coenzyme A carboxylase [ACC], fatty acid synthase [FASN], SREBP1, fatty acids binding protein [AP2]), as well as TG lipolysis genes (lipoprotein lipase [LPL], adipose triglyceride lipase [ATGL]) were used. Specific primer sequences were designed as Table 1. qRT-PCR was carried out with a BioRad Real-Time PCR system (Hercules, CA, USA).

Western blot analysis

Cells in the cell plate were rinsed twice with PBS and then lysed with RIPA buffer containing protease inhibitors. The protein concentration of each sample was determined and denatured at 100°C according to the instructions of the BCA Protein Assay Kit (Biosharp). Western blotting analyses were performed as previously described in the literature [22]. Protein lysates (20 μg/lane) were detected on 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis gels and transferred to polyvinylidene difluoride membranes. The membranes were then immersed in 5% skimmed milk for 2 h at room temperature, followed by incubation with anti-CRTC2 (1:500; PTM BIO, Hangzhou, China), anti-C/EBPα (1:1000; Cell Signaling, Danvers, MA, USA), and anti-β-actin (1:1,000; Cell Signaling) at 4°C overnight. The membranes were incubated with horseradish peroxidase-conjugated secondary antibody (1:5,000; Invitrogen, Waltham, MA, USA) for 1 h at room temperature. Finally, we detected the target proteins using enhanced chemiluminescence (Bio-Rad).

Statistical analysis

The qRT-PCR data were analyzed using the 2−ΔΔCt method, with qRT-PCR data presented as mean±standard error, and the significance of the data was analyzed using one-way analysis of variance (ANOVA) and t-tests, and significance of more than two groups were analyzed using multiple comparison tests. Statistical significance was considered when p<0.05. “*” indicates a significant difference (p<0.05) and “**” indicates a highly significant difference (p<0.01). The qRT-PCR results were plotted using GraphPad Prism 9.5.1.

RESULTS

Cloning of goat CRTC2 gene

PCR amplification yielded fragments of the expected target product size (Figure 1A). The goat CRTC2 gene is 2363 bp in length, of which the complete coding sequence (CDS) region is 2082 bp, which is consistent with the predicted sequence (XM_018046150.1). In contrast, the CDS region has two base mutations. Comparison revealed that the 807th locus has T>C and A>G at position 1806, but did not affect protein translation and were synonymous mutations (Figure 1B). The goat CRTC2 gene encodes a total of 693 amino acids, of which 102 are proline (Pro) and serine (Ser) in the highest proportion (14.7%), followed by 81 leucine (Leu, 11.7%, Figure 1C).

Bioinformatics analysis of the CRTC2 gene in goats

The secondary structure of CRTC2 was predicted using SOPMA software, and the structural composition of the protein had 18.47% (128 amino acids) of the total amino acids in α-helices, 7.79% (54 amino acids) in extended strands, 68.25% (473 amino acids) in random coils, and 5.48% (38 amino acids) in β-turns (Figure 2A). The amino acid sequence was analyzed using InterPro online software to predict the functional structural domains of CRTC2, and the protein was found to have three protein structural domains, TORC_N, TORC_M, and TORC_C, which are located at sites 18–72, 168–321, and 615–692 of the entire sequence (Figure 2B). The tertiary structure of CRTC2 was predicted using SWISS-MODEL, which was consistent with the secondary structure prediction (Figure 2C); The physicochemical properties of goat CRTC2 protein were analyzed using SOPMA software. The results showed that the molecular weight of goat CRTC2 protein was 73 kDa. The theoretical isoelectric point was 6.54, the instability coefficient was 82.41, and the Grand average of hydropathicity was -0.516. It was presumed that goat CRTC2 protein was an unstable hydrophilic acidic protein. Since there are more negatively charged amino acids than positively charged amino acids, the goat CRTC2 protein is negatively charged. The goat CRTC2 protein has 107 potential phosphorylation sites, including 88 serine (Ser) phosphorylation sites, 14 threonine (Thr) phosphorylation sites and 5 tyrosine (Tyr) phosphorylation sites (Figure 2D). Subcellular localisation predicts that CRTC2 protein is mostly distributed in the nucleus (73.9%), followed by vesicles (4.3%), cytoskeleton nucleus (65.2%), followed by mitochondria (17.4%), peroxisomes (8.7%), and cytoplasm (8.7%, Figure 2E). Prediction of CRTC2-interacting proteins by the STRING database showed that goat CRTC2 interacted strongly with proteins such as CRTC3, AKT2, CREB1, CREB2, SIK1 and SIK2 (Figure 2F).

Tissue and temporal expression analysis of goat CRTC2 gene

The results were compared with the expression level of heart. The results of qRT-PCR showed that the expression of CRTC2 gene was higher in the liver tissue of goats (p<0.05), followed by the kidney (p<0.05, Figure 3A). Different uppercase letters in the figure indicate highly significant differences (p<0.01), and different lowercase letters indicate significant differences (p<0.05), as below. The goat CRTC2 gene was differentially expressed from 0 to 120 h of subcutaneous precursor adipocyte differentiation, and the relative expression was up-regulated in all cases. The difference in up-regulation was not significant at 60 h compared to 0 h when cells were undifferentiated, and the expression level of CRTC2 was highly significantly up-regulated for the rest of the time period (p<0.01, Figure 3B).

Overexpression of CRTC2 promotes the differentiation of subcutaneous precursor adipocytes in goats

Agarose gel electrophoresis showed two bands of pEGFP-N1 (4733 bp) and CRTC2 (2082 bp) that were in line with the expected results, consistent with the sequencing results, indicating that the overexpression vector was successfully constructed (Figure 4A). The constructed pEGFP-N1-CRTC2 (named OE-CRTC2) or pEGFP-N1 (named NC) plasmids were transfected into goat subcutaneous precursor adipocytes for functional studies. CRTC2 expression was up-regulated approximately 1600-fold (p<0.01) as detected by qPCR, and western blot (WB) also verified the overexpression efficiency of CRTC2 in goat intramuscular precursor adipocytes (Figure 4B; Supplement 2). The formation of intracellular lipid droplets was visualized by Bodipy, DAPI and Oil Red O staining, and it was found that overexpression of CRTC2 promoted the subcutaneous adipocytes. The accumulation of intracellular lipid droplets was observed by Bodipy and Oil Red O staining (Figures 4C, 4D). The results of lysing the two groups of cells with isopropanol and detecting their absorbance values at 490 nm showed that the OD490 value of OE-CRTC2 was highly and significantly up-regulated compared with that of the NC group (p<0.01). To investigate the changes in the expression of lipid metabolism-related genes induced by CRTC2 overexpression, we assessed the expression of these genes in CRTC2 overexpressing cells (Figure 4E; Supplement 2). CRTC2 expression caused significant increases in the adipogenesis genes C/EBPβ and PPARγ (both p<0.01), the TG synthesis genes DGAT1, DGAT2 (both p<0.01), FASN (p<0.05) and TG catabolic genes LPL and ATGL (both p<0.01) were significantly increased. These data suggest that overexpression of CRTC2 promotes lipid accumulation in goat subcutaneous precursor adipocytes.

Si-CRTC2 inhibits the differentiation of subcutaneous precursor adipocytes in goats

To further verify the effect of CRTC2 on lipogenic differentiation of goat subcutaneous adipocytes, goat subcutaneous precursor adipocytes were transfected with Si-NC or Si-CRTC2 to inhibit the expression of CRTC2. Interference efficiency was measured by qRT-PCR and WB (Figure 5A, Supplement 2). The qRT-PCR data showed that, 48 h after transfection, the interference efficiency of Si-CRTC2 was greater than 60% compared to the Si-NC group. Oil Red O staining and semi-quantitative and Bodipy staining showed that inhibition of CRTC2 expression suppressed the accumulation of lipid droplets in goat subcutaneous adipocytes (Figures 5B-5D). In goat subcutaneous precursor adipocytes, Si-CRTC2 significantly down-regulated the mRNA expression levels of the adipogenic genes C/EBPα, C/EBPβ (both p<0.01), PPARγ (p<0.05), and the TG synthesis genes DGAT1, DGAT2, ACC, FASN, SREBP1 and the TG lipolysis gene ATGL (p<0.01, Figure 5E, Supplement 2). Taken together, these data further suggest that CRTC2 promotes lipogenic differentiation of goat subcutaneous precursor adipocytes.

DISCUSSION

Fat deposition is precisely regulated by many key genes. Therefore, it is important to reveal the genes that affect adipogenesis to promote subcutaneous fat deposition. In this study, we cloned the goat CRTC2 sequence of 2363 bp, which includes the complete CDS region of 2082 bp. As a member of the CRTC superfamily, deduced CRTC2 contains three typical features, including the n-terminal CREB-binding domain, the central regulatory domain, and the c-terminal transactivation domain, which are also found in CRTC2 protein sequences from other mammalian species [23,24].The protein interaction network shows that CRTC2 may interact with proteins such as CRTC3, AKT2, CREB1, CREB2, SIK1 and SIK2. In order to elucidate the function of CRTC2 in goats, this study utilized qRT-PCR to construct its expression level in various tissues of goats, and the results showed that the expression of CRTC2 in liver and kidney was significantly higher than that in other tissues. It has been shown that CRTC2 is the most abundant isoform in liver and pancreatic b-cells and plays an important role in the regulation of gluconeogenesis and cell survival [13].
In this experiment, we further examined the expression of CRTC2 in goat subcutaneous precursor adipocytes from 0 to 120 h, and found that the expression of CRTC2 existed throughout the differentiation process and reached the highest expression level at 120 h of induced differentiation. In order to finally elucidate the regulatory role of goat CRTC2 gene on the differentiation of subcutaneous adipocytes, the present experiments utilized overexpression and interference to study it in depth, and the results of Oil Red O staining and Bobipy staining showed that overexpression of the CRTC2 gene significantly promoted the accumulation of lipid droplets in intramuscular adipocytes of goats, and the interference of the CRTC2 gene significantly reduced the accumulation of lipid droplets, which was similar to the results of the study conducted by Han et al [25] in cattle.
To further elucidate its mode of action and molecular mechanism, the overexpression and changes of lipid metabolism-related marker genes in goat adipocytes after interfering with CRTC2 were examined. It was found that overexpression and interference with CRTC2 resulted in corresponding changes in the lipid synthesis marker genes PPARγ, C/EBPα and C/EBPβ. Many studies have found that PPARγ is a key transcription factor regulating adipocyte development [26], and the expression of PPARγ is induced in preadipocytes in response to a variety of factors in the lipogenic induced differentiation medium [27]. C/EBPα starts to be expressed at day 4 to 5 of adipocyte induced differentiation [28], while C/EBPβ is mainly expressed at the early stage of adipocyte differentiation [2933]. After overexpression of CRTC2, the expression of C/EBPα tended to be up-regulated, but not significantly, presumably due to the fact that adipocytes are at the early stage of 2 days of differentiation. Adipose precursor cells undergo changes in cell morphology and a series of related gene expression, and then differentiate into mature adipocytes with increased synthesis of triacylglycerols (TAG) and accumulation of lipids [34]. In this process, DGAT1, DGAT2, ACC, FASN, SREBP1, and AP2 are the key fat synthesizing enzymes, while ATGL is the key fat synthase. The FASN, SREBP1, and AP2 are the key lipogenic enzymes, while ATGL, LPL, are the key enzymes in lipid synthesis. ATGL and LPL are related lipolytic enzymes. DGAT1 shows high expression in the tissues or organs where TAG synthesis is most active [35]. Chen et al [36] found that high expression of DGAT1 gene increased adipocyte cell size, adiposity, and susceptibility to high-fat diet-induced obesity by constructing transgenic mice overexpressing the DGAT1 gene in white adipose tissue. Meanwhile DGAT2 plays a very important role in TAG synthesis and storage [37]. In human (Homo sapiens) body, FASN expression is low in most tissues and high in liver, adipose tissue and lactating mammary gland [38]. In this study, the expression of DGAT1, DGAT2 and FASN was significantly up-regulated after overexpression of CRTC2, and on the contrary, their expression was down-regulated after interference with CRTC2. It is hypothesized that there may be a positive regulatory relationship between CRTC2 and DGAT1, DGAT2, and FASN. LPL and ATGL likewise play important roles in the process of lipid deposition. The main function of LPL is to catalyze the hydrolysis of fatty esters and maintain lipid homeostasis in organisms. When ATGL is highly expressed in mice, adiposity is reduced in mice [39]. In this study, after overexpression of CRTC2, HSL and ATGL were significantly up-regulated during the induction and differentiation of subcutaneous precursor adipocytes. The above experimental results suggest that fat synthesis and catabolism are always in a dynamic equilibrium, and that lipolysis occurs at the same time as lipid synthesis, and that fat synthesis and catabolism work together to regulate the deposition of fat [31]. Combining the overexpression and interference results, the goat CRTC2 gene may promote adipocyte differentiation and influence the process of lipid deposition by up-regulating the expression of PPARγ, C/EBPβ, DGAT1, DGAT2, and FASN. However, the complete elucidation of the molecular mechanism by which goat CRTC2 regulates subcutaneous adipocyte differentiation still needs to be further explored.

CONCLUSION

In this study, the sequence of goat CRTC2 gene was cloned, which contained the complete CDS region of 2082 bp. The gene is mainly located in the nucleus and encodes a total of 693 amino acids. CRTC2 gene is mainly expressed in liver and kidney tissues, and the relative expression level is highest after 120 h of inducing lipogenic differentiation of goat subcutaneous adipocytes. Furtherly, we found that the overexpression of CRTC2 gene promote lipogenesis of goat subcutaneous precursor adipocytes.

Notes

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

AUTHORS’ CONTRIBUTION

Conceptualization: Li X, Lin Y.

Data curation: Li X, Hu T.

Formal analysis: Li X, Wang Youli.

Methodology: Li X, Hu T.

Software: Li X, Li Y.

Validation: Li X, Liu W.

Investigation: Li X, Wang Yong.

Writing - original draft: Li X.

Writing - review & editing: Li X, Hu T, Li R, Li Y, Lin Y, Wang Yong, Liu W, Wang Youli.

FUNDING

This work was supported by National Natural Sciences Foundation of China (32372857), Sichuan Science and Technology Program (Grant No. 2024NSFSC1171), and Innovative Graduate Student Research Program, Southwest Minzu University (ZD2023898).

ACKNOWLEDGMENTS

The authors acknowledge assistance from the goat lipid metabolism research lab.

DATA AVAILABILITY

Upon reasonable request, the datasets of this study can be available from the corresponding author.

ETHICS APPROVAL

All animal experiments were reviewed by Animal Experimental Ethical Inspection of Southwest University for Nationalities (No.2020086).

DECLARATION OF GENERATIVE AI

No AI tools were used in this article.

SUPPLEMENTARY MATERIAL

Supplementary file is available from: https://doi.org/10.5713/ab.24.0248
Supplement 1. Sequencing comparison of overexpressed pEGFP-CRTC2 vectors.
Supplement 2. A: Gray scale analysis of proteins overexpressing CRTC2.
ab-24-0248-Supplementary-Fig-1,2.pdf

Figure 1
Sequence analysis of the goat CRTC2 gene. (A) Goat CRTC2 gene amplification results. (B) CRTC2 gene sequence alignment with predicted sequence. (C) Amino acid composition of CRTC2 protein.
ab-24-0248f1.jpg
Figure 2
Bioinformatics analysis of the CRTC2 gene in goats. (A) Secondary-structure prediction. (B) Functional structure domain prediction. (C) Tertiary-structure prediction. (D) CRTC2 protein phosphorylation site prediction. (E) Subcellular localization. (F) Interaction protein prediction of goat CRTC2.
ab-24-0248f2.jpg
Figure 3
Tissue and temporal expression analysis of goat CRTC2 gene. (A) Distribution of CRTC2 in different tissues of goats. (B) Temporal expression profile of goat CRTC2 gene in subcutaneous precursor adipocytes. a–c p<0.05, A–I p<0.01.
ab-24-0248f3.jpg
Figure 4
Effect of overexpression of goat CRTC2 on adipocyte differentiation in subcutaneous precursor adipocytes. (A) Effect of overexpression of pEGFP-CRTC2 double enzyme digest product. (B) qRT-PCR and protein level image of overexpressing CRTC2 efficiency. (C) Oil red O staining and Semi-quantitative evaluation of absorbance assay of Oil Red O content performed at 490 nm. (D) Bodipy staining. (E) Effects of overexpression of CRTC2 on expression of lipid metabolism marker genes. * p<0.05, ** p<0.01. DAPI, 4′,6-diamidino-2-phenylindole; TG, triglycerides; qRT-PCR, quantitative reverse transcription polymerase chain reaction.
ab-24-0248f4.jpg
Figure 5
Effect of Si-CRTC2 on adipocyte differentiation in goat subcutaneous precursor adipocytes. (A) Transfection efficiency of Si-CRTC2 by qRT-PCR and WB. (B) Oil Red O staining. C: Semi-quantitative evaluation of absorbance assay for Oil Red O content at 490 nm. (D) BODIPY staining. (E) Effects of Si-CRTC2 on expression of marker genes of lipid metabolism. * p<0.05, ** p<0.01. DAPI, 4′,6-diamidino-2-phenylindole; TG, triglycerides; qRT-PCR, quantitative reverse transcription polymerase chain reaction; WB, Western blot.
ab-24-0248f5.jpg
Table 1
Primer information
Gene name Forward sequence (5′-3′) Reverse Sequence (5′-3′)
CRTC2 (clone) GTGGCTTGTATTGGGAGGGTG CGTGCCTTTTCTCATTCTTGG
CRTC2 (qRT-PCR) TTCCAATCCGCGTAAGTTTAGT CACAGCCAATCTGGTTCACAT
OE-CRTC2 CCGGAATTCATGGCGACGTCGGGAGCA CCGCTCGAGCTGAAGCCGGTCACTGCGGAA
Si-CRTC2 GUACCUCCAAUUUGACCCATT UGGGUCAAAUUGGAGGUACTT
Si-NC UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
UXT GCAAGTGGATTTGGGCTGTAAC ATGGAGTCCTTGGTGAGGTTGT
C/EBPα CTCCGGATCTCAAGACTGCC CCCCTCATCTTAGACGCACC
C/EBPβ CCGCCTTTAAATCCATGGAA CTCGTGCTCTCCGATGCTAC
PPARγ AAGCGTCAGGGTTCCACTATG GAACCTGATGGCGTTATGAGAC
AP2 TGAAGTCACTCCAGATGACAGG TGACACATTCCAGCACCAGC
SREBP1 AACATCTGTTGGAGCGAGCA TCCAGCCATATCCGAACAGC
FASN TGTGCAACTGTGCCCTAG GTCCTCTGAGCAGCGTGT
LPL GGTGACAGGAATGTATGAGAGTTGG CCCAAGGCTGTATCCCAAGAG
ATGL CAAGGAGACGACGTGGAACA CATAGATGTGCGTGGCGTTG
ACC GGAGACAAACAGGGACCATT ATCAGGGACTGCCGAAAC
DGAT2 CATGTACACATTCTGCACCGATT TGACCTCCTGCCACCTTTCT
DGAT1 CCACTGGGACCTGAGGTGTC GCATCACCACACACCAATTCA

qRT-PCR, quantitative reverse transcription polymerase chain reaction.

Table 2
Sequence analysis content and corresponding analysis tools
Analysis content Software tools used
Looking for open reading frames (ORFs) NCBI ORF Finder
Amino acid sequence analysis DNAMAN
Protein physical and chemical property analysis Protparam
Prediction of functional domain InterPro
Protein secondary-structure prediction SOPMA
Protein tertiary-structure prediction SWISS-MODEL
Phosphorylation site prediction Netphos
Subcellular localization PSORT II
Interacting protein prediction STRING

REFERENCES

1. Galic S, Oakhill JS, Steinberg GR. Adipose tissue as an endocrine organ. Mol Cell Endocrinol 2010;316:129–39. https://doi.org/10.1016/j.mce.2009.08.018
crossref pmid
2. Tran TT, Yamamoto Y, Gesta S, Kahn CR. Beneficial effects of subcutaneous fat transplantation on metabolism. Cell Metab 2008;7:410–20.
crossref pmid pmc
3. Fernandes F Jr, de Freitas Pena A, Grandis FA, et al. Subcutaneous fat thickness at slaughter in castrated and non-castrated santa ines and dorper lambs and its influence on meat and carcass quality. Livest Sci 2021;253:104694. https://doi.org/10.1016/j.livsci.2021.104694
crossref
4. Song SZ, Wu JP, Zhao SG, et al. The effect of energy restriction on fatty acid profiles of longissimus dorsi and tissue adipose depots in sheep. J Anim Sci 2017;95:3940–8. https://doi.org/10.2527/jas.2016.1235
crossref pmid
5. Ugnivenko A, Kruk O, Nosevych D, et al. The expressiveness of meat forms of cattle depending on the content of adipose tissue under the skin and between the muscles. Potravin J Food Sci 2023;17:358–70. https://doi.org/10.5219/1869
crossref
6. Han Y, He X, Yun Y, et al. The Characterization of subcutaneous adipose tissue in Sunit Sheep at different growth stages: a comprehensive analysis of the morphology, fatty acid profile, and metabolite profile. Foods 2024;13:544. https://doi.org/10.3390/foods13040544
crossref pmid pmc
7. Altarejos JY, Montminy M. CREB and the CRTC co-activators: sensors for hormonal and metabolic signals. Nat Rev Mol Cell Biol 2011;12:141–51. https://doi.org/10.1038/nrm3072
crossref pmid pmc
8. Conkright MD, Canettieri G, Screaton R, et al. TORCs: transducers of regulated CREB activity. Mol Cell 2003;12:413–23.
crossref pmid
9. Zhou Y, Wu H, Li S, et al. Requirement of TORC1 for late-phase long-term potentiation in the hippocampus. PLOS ONE 2006;1:e16. https://doi.org/10.1371/journal.pone.0000016
crossref pmid pmc
10. Song Y, Altarejos J, Goodarzi MO, et al. CRTC3 links catecholamine signalling to energy balance. Nature 2010;468:933–9. https://doi.org/10.1038/nature09564
crossref pmid pmc
11. Wu Z, Huang X, Feng Y, et al. Transducer of regulated CREB-binding proteins (TORCs) induce PGC-1alpha transcription and mitochondrial biogenesis in muscle cells. Proc Natl Acad Sci USA 2006;103:14379–84. https://doi.org/10.1073/pnas.0606714103
crossref pmid pmc
12. Zhang Y, Liu Y, Chen L, Wang Y, Han J. CRTC2 modulates hepatic SREBP1c cleavage by controlling Insig2a expression during fasting. Protein Cell 2018;9:729–32. https://doi.org/10.1007/s13238-018-0538-3
crossref pmid pmc
13. Koo SH, Flechner L, Qi L, et al. The CREB coactivator TORC2 is a key regulator of fasting glucose metabolism. Nature 2005;437:1109–14. https://doi.org/10.1038/nature03967
crossref pmid
14. Han HS, Kim SG, Kim YS, et al. A novel role of CRTC2 in promoting nonalcoholic fatty liver disease. Mol Metab 2022;55:101402. https://doi.org/10.1016/j.molmet.2021.101402
crossref pmid pmc
15. Han J, Li E, Chen L, et al. The CREB coactivator CRTC2 controls hepatic lipid metabolism by regulating SREBP1. Nature 2015;524:243–6. https://doi.org/10.1038/nature14557
crossref pmid
16. Li Y, Song Y, Zhao M, et al. A novel role for CRTC2 in hepatic cholesterol synthesis through SREBP-2. Hepatology 2018;67:1188. https://doi.org/10.1002/hep.29766
crossref pmid pmc
17. Han HS, Choi BH, Kim JS, Kang G, Koo SH. Hepatic Crtc2 controls whole body energy metabolism via a miR-34a-Fgf21 axis. Nat Commun 2017;8:1878. https://doi.org/10.1038/s41467-017-01878-6
crossref pmid pmc
18. Zhong YW, Chu WY, Xu YQ, et al. Cloning and expression features of CRTC2 gene in Nile tilapia. J South Agric 2018;49:2539–44.
crossref
19. Fang WL, Lee MT, Wu LS, et al. CREB coactivator CRTC2/TORC2 and its regulator calcineurin crucially mediate follicle-stimulating hormone and transforming growth factor β1 upregulation of steroidogenesis. J Cell Physiol 2012;227:2430–40. http://doi.org/10.1002/jcp.22978
crossref pmid
20. Wu L, Liu RL, Yuan W, et al. Analysis of CRTC2 gene expression in cattle of different varieties and months of age. Anim Husb Vet Med 2019;51:9–14.
crossref
21. Li X, Zhang H, Wang Y, et al. RNA-seq analysis reveals the positive role of KLF5 in the differentiation of subcutaneous adipocyte in goats. Gene 2022;808:145969. https://doi.org/10.1016/j.gene.2021.145969
crossref pmid
22. Chen D, Li Y, Hu T, et al. PDZK1-interacting protein 1 (PDZKIP1) inhibits goat subcutaneous preadipocyte differentiation through promoting autophagy. Animals 2023;13:1046. https://doi.org/10.3390/ani13061046
crossref pmid pmc
23. Wang Y, Inoue H, Ravnskjaer K, et al. Targeted disruption of the CREB coactivator Crtc2 increases insulin sensitivity. Proc Natl Acad Sci USA 2010;107:3087–92. https://doi.org/10.1073/pnas.0914897107
crossref pmid pmc
24. Screaton RA, Conkright MD, Katoh Y, et al. The CREB coactivator TORC2 functions as a calcium- and cAMP-sensitive coincidence detector. Cell 2004;119:61–74.
crossref pmid
25. Han HS, Kim SG, Kim YS, et al. A novel role of CRTC2 in promoting nonalcoholic fatty liver disease. Mol Metab 2022;55:101402. http://doi.org/10.1016/j.molmet.2021.101402
crossref pmid pmc
26. Zhuang H, Zhang X, Zhu C, et al. Molecular mechanisms of PPAR-γ governing MSC osteogenic and adipogenic differentiation. Curr Stem Cell Res Ther 2016;11:255–64. https://doi.org/10.2174/1574888X10666150531173309
crossref pmid
27. Schupp M, Cristancho AG, Lefterova MI, et al. Re-expression of GATA2 cooperates with peroxisome proliferator-activated receptor-γ depletion to revert the adipocyte phenotype. J Biol Chem 2009;284:9458–64. http://doi.org/10.1074/jbc.M809498200
crossref pmid pmc
28. Cao Z, Umek RM, McKnight SL. Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev 1991;5:1538–52. https://doi.org/10.1101/gad.5.9.1538
crossref pmid
29. Farmer SR. Transcriptional control of adipocyte formation. Cell Metab 2006;4:263–73.
crossref pmid pmc
30. Sun CJ, Xu HQ, Zhao JF, Chen W, Zhou D, Zhang QQ. The expression of related genes on intramuscular and subcutaneous preadipocytes during differentiation in Congjiang Xiang pig (Sus scrofa). J Agric Biotechnol 2017;25:1979–88.
crossref
31. Tang QQ, Zhang JW, Daniel Lane M. Sequential gene promoter interactions of C/EBPβ, C/EBP α, and PPARγ during adipogenesis. Biochem Biophys Res Commun 2004;319:235–9. https://doi.org/10.1016/j.bbrc.2004.04.176
crossref pmid
32. Muruganandan S, Ionescu AM, Sinal CJ. At the crossroads of the adipocyte and osteoclast differentiation programs: future therapeutic perspectives. Int J Mol Sci 2020;21:2277. https://doi.org/10.3390/ijms21072277
crossref pmid pmc
33. Yan H, Li Q, Li M, et al. Ajuba functions as a co-activator of C/EBPβ to induce expression of PPARγ and C/EBPα during adipogenesis. Mol Cell Endocrinol 2022;539:111485. https://doi.org/10.1016/j.mce.2021.111485
crossref pmid
34. Shen WJ, Yu Z, Patel S, Jue D, Liu LF, Kraemer FB. Hormone-sensitive lipase modulates adipose metabolism through PPARγ. Biochim Biophys Acta Mol Cell Biol Lipids 2011;1811:9–16. https://doi.org/10.1016/j.bbalip.2010.10.001
crossref pmid pmc
35. Nonneman D, Rohrer GA. Linkage mapping of porcine DGAT1 to a region of chromosome 4 that contains QTL for growth and fatness. Anim Genet 2002;33:472. https://doi.org/10.1046/j.1365-2052.2002.00938_5.x
crossref pmid
36. Chen HC, Smith SJ, Ladha Z, et al. Increased insulin and leptin sensitivity in mice lacking acyl CoA:diacylglycerol acyltransferase. J Clin Invest 2002;109:1049–55. https://doi.org/10.1172/JCI14672
crossref pmid pmc
37. Stone SJ, Myers HM, Watkins SM, et al. Lipopenia and skin barrier abnormalities in DGAT2-deficient mice. J Biol Chem 2004;279:11767–76.
crossref pmid
38. Fan H, Wu D, Tian W, Ma X. Inhibitory effects of tannic acid on fatty acid synthase and 3T3-L1 preadipocyte. Biochim Biophys Acta Mol Cell Biol Lipids 2013;1831:1260–6. https://doi.org/10.1016/j.bbalip.2013.04.003
crossref
39. Ahmadian M, Duncan RE, Varady KA, et al. Adipose overexpression of desnutrin promotes fatty acid use and attenuates diet-induced obesity. Diabetes 2009;58:855–66. https://doi.org/10.2337/db08-1644
crossref pmid pmc


Editorial Office
Asian-Australasian Association of Animal Production Societies(AAAP)
Room 708 Sammo Sporex, 23, Sillim-ro 59-gil, Gwanak-gu, Seoul 08776, Korea   
TEL : +82-2-888-6558    FAX : +82-2-888-6559   
E-mail : editor@animbiosci.org               

Copyright © 2026 by Asian-Australasian Association of Animal Production Societies.

Developed in M2PI

Close layer
prev next