Go to Top Go to Bottom
Anim Biosci > Volume 38(2); 2025 > Article
Lim, Kim, Cheon, Park, and Hong: Reduced aggregation of the leghorn male hepatoma cell line in suspension by supplementing dextran sulfate in the media

Abstract

Objective

The study aimed to improve the efficiency of leghorn male hepatoma (LMH) cells for animal virus vaccine production by transitioning from adherent to suspension culture and evaluating the effects of dextran sulfate (DS) on preventing cell aggregation. The goal was to enhance cell growth, viability, and glucose metabolism and to develop efficient suspension-adapted LMH cells for large-scale vaccine production.

Methods

LMH cells previously cultured in an adherent state were transferred to 125 mL Erlenmeyer flasks to conduct suspension culture. Cell culture performance, including cell density, viability, and glucose metabolism, during the cultures was measured, along with an assessment of cell aggregation. Additionally, mRNA expression levels of genes associated with cell adhesion and apoptosis were monitored.

Results

DS supplementation in suspension culture enhanced cell viability and growth, with higher cell densities and viabilities compared to control media. Additionally, DS supplementation reduced glucose consumption and waste production, indicating improved metabolic efficiency. DS also delayed cell aggregation, possibly by downregulating integrin expression and promoting anti-apoptotic gene expression. However, even after 2 months, cell aggregation persisted in both control and DS-supplemented cultures, suggesting further optimization is needed for LMH cell adaptation to suspension culture.

Conclusion

DS supplementation in LMH cell suspension cultures led to notable improvements in cell growth, viability, and glucose metabolism, while also decreasing the cell aggregation.

INTRODUCTION

Animal cell lines are crucial as cell factories for biopharmaceutical production, such as therapeutic proteins and vaccines [1]. While Chinese hamster ovary (CHO) and human embryonic kidney 293 (HEK293) cells are primary hosts for producing human therapeutic proteins and viral-based products, many other immortalized animal cell lines such as Madin-Darby canine kidney (MDCK), Vero, Medical Research Council cell strain 5 (MRC-5), chicken embryo lung (CEL), and leghorn male hepatoma (LMH) are also utilized for viral-based vaccine production [26]. Achieving large-scale commercial production with these animal-derived host cells requires high-density and easily up-scaled cell cultivation. Traditionally, large-scale cultivation of animal cells, which generally proliferate in an attached state, utilized roller bottles, multi-layered cell factory flasks, or the scale-out approach employing multiple flasks to increase the attachment surface area [7,8]. However, these methods have drawbacks, including time-consuming steps like trypsin treatment for cell detachment, which also increases the risk of contamination, thereby limiting the production efficiency.
To overcome these challenges, there is a growing focus on adapting animal cells from attachment to suspension cultivation, which simplifies sub-culture and reduces the constraints on scale-up, as it does not require trypsin treatment or medium exchange. This approach is particularly critical for vaccine development in the livestock and poultry industries, where industrial application has been constrained by the need for various animal-derived host cells and the lack of basic research supporting large-scale cell cultivation. In the poultry industry, vaccines are essential for ensuring food security and controlling zoonotic diseases such as avian influenza. Therefore, optimizing the suspension culture of LMH host cells, which are representative poultry cells, emerges as a pressing technology in poultry vaccine manufacturing research. [911].
Many studies have successfully implemented suspension culture of animal cells for human biopharmaceutical production, i.e., suspension cultures of CHO cells for monoclonal antibodies and HEK293 cells for gene therapy [12,13]. In the production of animal therapeutics, however, conventional adherent culture methods are primarily employed. In particular, cells derived from chickens, like DF-1 and LMH, which are crucial for avian virus vaccine development, predominantly undergo adherent culture [1416]. Considering that avian viruses pose significant economic threats to the poultry industry and potential public health risks through zoonotic transmission [17], there is an urgent need for swift and efficient vaccine mass production. To address this challenge, further exploration of suspension culture is imperative.
Adapting cells to suspension culture is a time-consuming and difficult process that does not guarantee successful adaptation. Moreover, when animal cells grown in an attached state are transferred into the suspension culture, large cell clumps can quickly form due to the molecules involved in cell surface adhesion [1821]. Since large cell aggregates create imbalances between internal and external cells in terms of nutrient supply and gas exchange, heterogeneous metabolic activities are induced in the bioreactor, decreasing cell viability and productivity and batch-to-batch consistency [22,23]. Therefore, suspension culture without cell aggregates is crucial for improving bioprocess performance. Several methods have been employed to resolve these cell aggregation problems in suspension cultures, such as long-time subcultures in suspension, clonal isolation of fully adapted clones, and media development for reduced cell aggregation [24]. For example, the addition of certain enzymes, polymers, surfactants, and other substances to the medium can prevent cell aggregation [2528]. In addition, dextran sulfate (DS), a complex polysaccharide, decreases cell-cell adhesion and aggregation in suspension culture [11,2933]. This effect is attributed to the negative charges on sulfate groups, inducing electrostatic repulsion between these negative charges on the cell surface [34]. Since DS is usually added to the suspension culture media for animal-derived cell lines such as CHO and HEK cells due to its anti-clumping effect, it would be meaningful to explore the inhibitory effects of DS on cell aggregation of avian-derived LMH cells in a suspension culture.
In this study, we investigated the impact of DS in the medium on suspended cell cultures of LMH cells. We observed changes in cellular metabolism, cell aggregation, and expression of cell-cell adhesion- and apoptosis-related proteins to investigate the effects of DS in the medium.

MATERIALS AND METHODS

Cell cultures

The adherent LMH cell line was cultured in T-flasks pre-coated with 0.1% gelatin (Sigma-Aldrich, Saint Louis, MO, USA) with Iscove’s modified Dulbecco’s medium (IMDM) supplemented with 4 mM glutamine and 10% (v/v) fetal bovine serum (FBS) (Gibco, Waltham, MA, USA). Flasks were incubated in an ANICELL CO2 incubator (N-Biotek, Bucheon, Korea) at 5% CO2, 95% humidity, and 37°C. To conduct subculturing or sampling, supernatants were collected, cells in the T-flask were trypsinized, and viable cell density (VCD) and viability were measured.
To conduct suspension culture, LMH cells grown in the attached state were inoculated into 125 mL Erlenmeyer flasks (Corning, Corning, NY, USA) with a working volume of 30 mL and a seeding density of 0.3×106 cells/mL. Suspension flasks were incubated in the same CO2 incubator but with a 110 rpm agitation speed. Medium for the control condition was IMDM supplemented with 4 mM glutamine and 10% (v/v) FBS (Gibco, USA). For the DS-supplemented condition, DS of 100 mg/L (Catalog number: 31404; Sigma-Aldrich, USA) was added to the control medium. During suspension cultivation, sampling was performed every 2 days to analyze VCD, viability, and concentrations of metabolites.
In addition, adherent LMH cells were inoculated at a density of 1.0×106 cells/1.5 mL/well in 24-well plates (Corning, USA). These 24-well plates were incubated in a Kuhner shaking incubator (Kuhern Shaker Inc, San Carlos, CA, USA) set to 37°C, humified 5% CO2, and 200 rpm.
For long-term subcultures, LMH cells in an Erlenmeyer flask were subcultured for 18 passages at intervals of 3 to 4 days. During each subculture, VCD, viability, and metabolites were measured, and then cells were re-inoculated into a clean Erlenmeyer flask at a concentration of 0.3×106 cells/mL for the next passage.

Culture analysis

Viable cell concentration and viability of the cultures were analyzed using a Vi-Cell XR cell counter (Beckman-Coulter, Brea, CA, USA). Residual concentrations of glucose, lactate, and ammonia in culture supernatants were measured using an RX Misano (Randox, Antrim, UK). For gene expression level analysis, cells were harvested, washed twice with phosphate-buffered saline, and centrifuged at 10,000 rpm. The supernatant was removed, and cell pellets were stored in −80°C in a deep-freezer for later analysis. Microscopy images of cells on a 24-well plate were captured using an Eclipse TE2000-U microscope (Nikon, Tokyo, Japan) every 24 hours.

Real-time reverse-transcriptase polymerase chain reaction

The mRNA extraction followed the manufacturer’s instructions for RNeasy Kits (Qiagen, Venlo, Netherlands) using cultured cell pellets. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin served as reference genes. Expression levels of BH3 Interacting Domain Death Agonist (BID), Caspase 9, and BCL-xL were analyzed for cellular apoptosis, while E-cadherin, integrin α2, integrin αV, integrin β1, and integrin α6 were analyzed for cell adhesion. Real-time reverse-transcriptase polymerase chain reaction was performed using the StepOnePlus System (Applied Biosystems, Waltham, CA, USA) with SYBR green. The comparative Ct (ddCt) method was used to calculate the expression levels of genes. Primers used in this study are shown in Table 1.

Statistical analysis

Results of all experiments are expressed as mean±standard error of the mean. The statistical significance of the compared data sets was analyzed by paired, parametric test. Paired t-test or multiple-paired t-tests were performed using Graphpad Prism 9 software (Graphpad Software, Boston, CA, USA). Results of p-values which were set at p<0.05, considered to be significant in the data sets (* p<0.05, ** p<0.01, *** p<0.005).

RESULTS

Culture profiles of attached leghorn male hepatoma cells in T-flask cultivation

Before investigating the impact of DS supplementation on the suspension culture performance of LMH cells, we first examined the inherent cell culture performance of LMH cells in an adherent state (Figure 1). LMH cells were inoculated into gelatin-coated T-25 flasks at a concentration of 0.30×106 cells/mL to perform batch culture, where cell growth, viability, nutrient, and waste concentrations were measured every two days. Most viable cells were on the surface of the flask, although 10% of them were present in the culture medium (data not shown). Therefore, cell density and viability were considered for both cells attached to the flask and those present in the culture medium. During batch culture, a maximum cell density of 0.98±0.11 ×106 cells/mL was observed on day 6. The specific growth rate during days 0 to 4 was 0.27±0.02 day−1, lower than that of CHO cells [35], which are commonly used for protein production. After reaching the peak VCD on day 6, a decrease in viability was observed for days 6 to 10, reaching 81.60%±0.83% on day 10. The glucose in the initial medium was continuously consumed at a rate of glucose consumption of −6.46±0.30 pmol/cell/d (days 0 to 4). After peak VCD on day 6, glucose concentration dropped below 5 mM, establishing a correlation between cell death and low glucose concentration. Lactate, a major waste product of cell culture, was produced at a production rate of 6.05±0.13 pmol/cell/d until day 4. After a maximum concentration of 17.0 mM on the 6th day, lactate concentration was maintained. Another major waste product, ammonia [27,36], was maintained at levels below 3.9 mM throughout the culture period.

Effect of dextran sulfate on the culture performance of leghorn male hepatoma cells in suspension

We then investigated the impact of DS supplementation on cell growth and metabolism of the LMH cells in suspension culture derived from an attachment culture. Exponentially-growing LMH cells from T-flasks were inoculated into Erlenmeyer flasks, and suspension batch cultures were conducted in a shaking incubator at 110 rpm (Figure 2). Two types of media were used in this batch culture: i) control medium used for adherent culture; and ii) medium supplemented with DS. Cell density; viability; and glucose, lactic acid, and ammonia concentrations were measured at 2-day intervals after inoculation. In both control and DS-supplemented media, significant cell aggregation was observed over time, as shown in Figure 3. To accurately determine the VCD, the cell culture broth prepared for sampling underwent 1 hour of trypsinization to dissociate the aggregated cells. However, this method did not fully dissociate cell clumps into single cells, complicating the measurement of cell density, particularly after day 4. Despite this, incorporating DS into the medium enhanced the viability of LMH cells in comparison to the control medium.
DS supplementation exhibited a positive impact on the performance of LMH cell cultures (Figure 2). When DS was added to the medium, VCD reached 0.66±0.07 ×106 cells/mL with a viability of 99.0%±0.0% on day 2, surpassing the 0.50±0.05 ×106 cells/mL and 97.1%±0.0% respective values of the control. Similarly, by day 4, the VCD and viability in the DS-supplemented condition (0.85×106 cells/mL and 98.1%±0.0%) were higher compared to the control (0.6.1± 0.0 ×106 cells/mL and 97.9%±0.0%). Throughout the cultures, spent media were collected and analyzed for glucose, lactic acid, and ammonia concentrations. Notably, DS supplementation led to reduced glucose consumption and lower production of the waste products lactate and ammonia. This result suggests that adding DS to the media may enhance cell metabolism efficiency, resulting in improved cell growth and viability while utilizing less glucose and generating smaller amounts of waste products.

Effect of dextran sulfate on the aggregation of leghorn male hepatoma cells in suspension

In both suspension culture conditions above, even though single cells were initially inoculated, a noticeable formation of cell clumps was observed as the cultures progressed, suggesting rapid increase of cell-to-cell interaction. Interestingly, the degree of cell aggregation was significantly reduced in the DS-supplemented medium (Data not shown), leading to enhanced culture performance in terms of cell growth and viability (Figure 2). To evaluate the process of cell aggregation in suspension cultures, cells were inoculated into a 24-well plate for suspension culture, and the plates were moved from the incubator to monitor the formation of cell clumps in a well via a microscope for 3 days (Figure 3).
Each well was captured in 16 images to observe all cells present. In Figure 3A, the control condition exhibited 5 to 6 small clumps 24 hours after inoculation; 48 hours later, two large clumps formed, accompanied by a significant decrease in the number of single cells. By 72 hours, single cells were rare, replaced with numerous cell clumps. Therefore, transitioning LMH cells from an adherent state to a suspension culture significantly induced cell aggregation. In contrast, in the DS-supplemented medium, no cell clumps were observed 24 hours after inoculation. At 48 hours, there were still no cell clumps, but several connected cells were observed (Figure 3B). By 72 hours, multiple cell clumps were identified, but a significant number of individual cells was present. The images obtained during the 3-day suspension culture in a DS-supplemented medium demonstrated that the addition of DS delayed cell aggregation of LMH cells.

Effect of dextran sulfate on the transcription levels of cell-aggregation-related genes

To investigate the effect of DS in the media on the expression levels of genes involved in cell-cell interaction and cell survival, mRNA levels of such genes were quantitatively analyzed using the cells 72 hours post-inoculation, as in Figure 3.
The expression levels of integrin family proteins (which play a crucial role in integrin-dependent cell adhesion) were analyzed (Figure 4A). Integrins are heterodimeric cell-binding transmembrane proteins composed of alpha and beta subunits. Interestingly, adding DS in the media decreased the expression of integrin αV, α6, and β1, while slightly increasing the integrin α2 expression level. The reduction in integrin expression can account for diminished cell aggregation since integrins facilitate the interactions between cells and the extracellular matrix (ECM) [37]. Consequently, it is expected that DS treatment on LMH cells will induce associations of various integrin subunits and trigger divergent signaling pathways from regular cellular differentiation. Additionally, expression of E-cadherin, a marker of epithelial cells, decreases with DS treatment, as expected. Overall, these results confirmed that DS supplementation decreased the characteristics of epithelial cells, possibly due to cell aggregation.
To identify whether the enhanced cell survival observed with DS addition in suspended LMH cells is associated with the regulation of genes involved in cell survival and apoptosis, the expression levels of Caspase 9, BID, and Bcl-xL were analyzed (Figure 4B). As expected, DS addition decreased the expression of pro-apoptotic genes Caspase 9 and BID and increased the expression of the anti-apoptotic gene Bcl-xL, increasing cellular viability.

Effect of dextran sulfate on long-term culture of leghorn male hepatoma cells

To investigate the impact of DS in the medium on the long-term culture performance of LMH cells (i.e., cell growth, viability, and metabolic processes), consecutive subcultures of LMH cells were performed every 3 to 4 days for 2 months using an initial inoculation of 0.3×106 cells/mL in the control and DS-supplemented media conditions. Despite the suspension culture of LMH cells for 2 months, there was no reduction in cell aggregation in either of the media, suggesting that neither was suitable for adaptation of LMH cells to suspension culture (data not shown). Consequently, there was a challenge in precisely measuring and controlling cell inoculation densities due to the presence of aggregated cell clumps. Despite fluctuations in cell density, the statistical processing of cell culture data over 18 passages consistently demonstrated that the addition of DS improved the cell growth profile (Figure 5), which is consistent with the results shown in Figure 2. The average VCD and viability at day 3 or day 4 in the DS-supplemented medium increased by 16% and 13%, respectively, resulting in an improvement of 66% in the average cell growth rate (Figure 5A). Compared to the control condition, the DS-supplemented medium decreased glucose consumption rate by 24%, along with decreases of 33% and 27% in lactate and ammonia production rates, respectively (Figure 5B5D). These findings are consistent with those depicted in Figure 2 and demonstrate the beneficial effects of DS on LMH cell growth and simultaneous reduction of cell aggregation during long-term suspension culture. However, the persistence of cell aggregation even after 2 months of cultivation indicates that the DS in the growth medium is not sufficient for adaptation of LMH cells to suspension culture.

DISCUSSION

We evaluated the impact of DS supplementation in the suspension culture media on culture performance and cell aggregation of LMH cells used for vaccine production. LMH cells initially grown in attached cultures were inoculated into a suspension flask with a medium supplemented with DS. Adding DS decreased the size and number of cell clumps and enhanced culture performance. In addition, reduced cell-cell adhesion by DS addition was coordinated with biological responses, such as changes in gene expression. While cell aggregation decreased in the DS-supplemented medium, the formation of cell clumps could not be completely resolved even after 2 months of continuous subculturing.
DS, an anionic polysaccharide sulfate, is known to mitigate cell aggregation in various animal cell models by disrupting the interactions between cells and ECM [2934]. The ECM is a structural and functional network that surrounds cells and consists of proteins, polysaccharides and proteoglycans. Importantly, ECM provides binding sites for cell adhesion molecules (CAMs) such as integrins, cadherins, selectins, and membrane proteins, which play crucial roles in the process of cell aggregation [38]. The negative charge of DS can create electrostatic repulsion with the negative charges of polysaccharides in the ECM, such as heparan sulfate proteoglycan, interfering with the interactions between the ECM and binding proteins [26,28]. The physicochemical changes in this ECM seem to affect signaling pathways that modulate the expression of adhesion proteins, influencing cell growth and survival. In this study, the addition of DS resulted in decreased expression of adhesion proteins, particularly E-cadherin and integrins (αV, α6, and β1), alongside enhancements in cell growth and viability. It is still unclear whether physicochemical stimuli directly induce signal transduction for promoting cell growth or whether a reduction in cell clump size improves cell growth by enhancing nutrient and oxygen supply to the cells inside the clumps. More investigation is required to comprehend the signaling mechanisms occurring in the ECM.
The mechanism of aggregation reduction by adding DS to the medium has similarities and differences with that of epithelial-mesenchymal transition (EMT), where epithelial cells, characterized by strong cell-cell adhesion, undergo a transition to mesenchymal cells, which exhibit enhanced mobility due to loss of cell-cell adhesion [39]. While DS supplementation and EMT differ in their induction mechanisms—DS disrupts interactions between molecules in the ECM, while EMT is driven by transcription factor-mediated gene expression regulation—both processes involve altering the expression of CAMs and remodeling the composition of the ECM to regulate cell aggregation [32,39]. As mentioned above, DS addition led to a decrease in epithelial markers such as E-cadherin and integrin αV, α6, and β1, which are typical CAMs expression patterns during EMT. However, integrin α2, which is important for collagen interaction and is reported to decrease in EMT, was slightly increased by DS addition. Therefore, both EMT and DS addition seem to influence CAM expression and cell aggregation, but they may induce different physiological responses in a context-dependent manner.
In this study, long-term subcultures were performed in DS-supplemented medium to adapt LMH cells to suspension culture (Figure 5). Suspension adaptation means transitioning adherent-derived cells to grow as individual cells without clumping in suspension flasks. Unfortunately, LMH cells continued to form cell clumps even after 2 months of subculturing in DS-supplemented media, while the level of clump formation was lower compared to the control condition. This result indicates that DS supplementation alone is insufficient for achieving successful adaptation of LMH cells to suspension culture. The suspension adaptation of mammalian cells can be influenced by various factors, including the inherent characteristics of the cells, the composition of the suspension medium, and the adaptation methods to suspension culture [24,40]. Among them, this study may have limitations in terms of suspension media composition. For example, the FBS utilized in the suspension culture medium in this study may have a negative effect on the suspension adaptation. While FBS contains numerous components essential for cell growth, such as growth factors and vitamins, it may also contain components like fibronectin and laminin, which can promote cell aggregation [41]. Hence, suspension culture in serum-free media might have better adaptation performance, as observed in a few previous studies on adaptation to suspension culture for certain animal cells or adopting a sequential approach involving serum reduction before transitioning to suspension culture [42,43]. In summary, while the addition of DS to the medium demonstrated a clear effect in reducing cell aggregation during the transition of LMH cells to suspension culture, it may be necessary to consider additional factors for complete adaptation to suspension culture.
In conclusion, we explored the impacts of DS supplementation on the culture performance, aggregation behavior, and long-term adaptation of LMH cells in suspension culture. While many animal cell lines are being utilized for vaccine production hosts, establishing an LMH cell line as an effective host capable of efficient large-scale production would expedite the supply of vaccines and treatments for various diseases that are threatening both to poultry and to many other animals. Furthermore, it could offer significant potential for overcoming human health crises.

Notes

CONFLICT OF INTEREST

We certify that there is no conflict of interest with any organization regarding the materials discussed in the manuscript.

FUNDING

The authors received no financial support for this article.

Figure 1
The culture performance of LMH cells in adherent culture. LMH cells were inoculated into 0.1% gelatin pre-coated T25 flasks with a seeding density of 0.3×106 cells/mL. Sampling was conducted every 2 days. (A) VCD; (B) viability; (C) specific growth rate during days 0 to 4, (D) specific death rate during days 0 to 4; (E) concentrations of glucose (circle), lactate (square), and ammonia (triangle) of the culture supernatants; (F) specific rate of metabolite during days 0 to 4. Error bars indicate standard deviation calculated from three independent experiments. LMH, leghorn male hepatoma; VCD, viable cell density.
ab-24-0372f1.jpg
Figure 2
The culture performance of LMH cells in suspension culture. Exponentially growing LMH cells were inoculated in a 125 mL Erlenmeyer flask with the VCD of 0.3×106 cells/mL, and sampling was conducted every two days. Working volume and agitation speed were 30 mL and 110 rpm respectively. (A) Viable cell density; (B) viability; (C) specific growth rate (day 0 to day 4); (D) specific death rate (day 0 to day 4); (E) residual concentrations of glucose; (F) lactate; and (G) ammonia (triangle) of the culture supernatants; and (H) specific production rates of metabolites. Error bars indicate standard deviation calculated from three independent experiments. LMH, leghorn male hepatoma; VCD, viable cell density. Paired t-test was performed to analyze statistical significance (* p<0.05, ** p<0.01).
ab-24-0372f2.jpg
Figure 3
Time-lapse photo images of LMH cell aggregation in suspended 24-well plate cultures. LMH adherent cells were inoculated into a 24-well plate at a density of 1×106 cells/1.5 mL/well, followed by suspension cultures with an agitation speed of 200 rpm. The entire area of a single well was captured with 16 photos at 24-hour intervals for 3 days. The formation of cell clumps was delayed in the DS-supplemented medium compared to the control medium, and both the size and number of aggregates decreased. (A) Images of the LMH cells in the control condition; and (B) images of the LMH cells in the DS-supplemented condition. LMH, leghorn male hepatoma; DS, dextran sulfate.
ab-24-0372f3.jpg
Figure 4
Relative expression levels of cell adhesion-related and apoptosis/survival-related genes of LMH cells in suspension cultures. Differential mRNA levels of the LMH cells on day 3 in 24-well plate suspension cultures were analyzed by quantitative real-time polymerase chain reaction; control medium (black-colored bar), DS-supplemented medium (grey-colored bar). (A) Genes related to cell adhesion: integrin αV, integrin α6, integrin β1, integrin α2, and E-Cadherin. (B) Genes related to pro-apoptosis (Caspase 9, BID) and anti-apoptosis (BCL-xL). Error bars indicate standard deviation calculated from three independent experiments. LMH, leghorn male hepatoma; DS, dextran sulfate; BID, BH3 interacting-domain death agonist. Multiple-paired t-tests was performed to analyze statistical significance (* p<0.05).
ab-24-0372f4.jpg
Figure 5
Comparative culture performance of LMH cells during 17 subculture passages between the control and DS-supplemented media. Adherently grown LMH cells were inoculated into suspension culture flasks containing 2 different media. Over a period of 2 months, cells were subcultured every 3 to 4 days, totaling 17 passages in 125 mL Erlenmeyer flasks. During each passage, (A) SGR; (B) specific glucose consumption rate (qGlc); (C) specific lactate production rate (qLac); and (D) specific ammonia production rate (qNH3) were computed. An overall assessment of culture performance between the control and DS-supplemented media was conducted. The DS-supplemented medium exhibited higher SGR, decreased glucose consumption, and reduced lactate and ammonia production compared to the control medium. LMH, leghorn male hepatoma; DS, dextran sulfate; SGR, specific growth rate. Paired t-test was performed to analyze statistical significance (** p<0.01, *** p<0.005).
ab-24-0372f5.jpg
Table 1
Primer sequences used in quantitative real-time reverse-transcription polymerase chain reaction analysis
Gene Primer sequence (5′-3′) Role
GAPDH F
R
CCACATGGCATCCAAGGAGT
GAACTGAGCGGTGGTGAAGA
Reference gene
β-Actin F
R
ATCTTTCTTGGGTATGGAGTC
GCCAGGGTACATTGTGG
Reference gene
Integrin αV F
R
CCTACACCATGGGAGGGGTA
GCAGCCACAGTCCAAGATCT
Cell adhesion
Integrin α6 F
R
GCTGGAAACATGGACCTGGATAA
TTCAGGTCAAGTTTGTCAGGCTGTA
Cell adhesion
Integrin β1 F
R
TGTTTGTGGGGACCAGATTG
CCAGGTGACATTTCCCATCA
Cell adhesion
Integrin α2 F
R
CGCAGACAACAGGAGTCCTC
AGCATTATTTGTGGCCGTGC
Cell adhesion
E-cadherin F
R
GACAGGGACATGAGGCAGAA
GCCGTGACAATGCCATTCTC
Cell adhesion
CP9 F
R
CCGAAGGAGCAAGCACG
AGGTTGGACTGGGATGGAC
Pro-apoptotic
BID F
R
CTGTGAAAGGGAAGGCAGAG
GCTACCAAAAAGGAGAGGGAA
Pro-apoptotic
Bcl-xL F
R
CTTTCAGCGACCTCACCTC
ACAATGCGTCCCACCAGT
Anti-apoptotic
Table 2
Values of Ct and delta Ct in quantitative real-time reverse-transcription polymerase chain reaction data analysis
Gene Ct value ΔCt value p-value
Integrin αV Integrin αV Control 24.061 3.218 0.03*
Dextran sulfate 28.875 5.326
Integrin α6 Integrin α6 Control 23.789 2.945 0.1
Dextran sulfate 27.371 3.822
Integrin β1 Integrin β1 Control 23.935 3.478 0.01*
Dextran sulfate 28.333 5.032
Integrin α2 Integrin α2 Control 28.040 7.196 0.52
Dextran sulfate 30.626 7.077
E-Cadherin E-Cadherin Control 23.121 2.277 0.1
Dextran sulfate 26.409 2.860
Caspase 9 Caspase 9 Control 24.751 4.294 0.28
Dextran sulfate 28.096 4.795
BID BH3 interacting-domain death agonist Control 24.363 3.519 0.01*
Dextran sulfate 27.804 4.255
BCL-xL BCL-xL Control 26.470 5.626 0.43
Dextran sulfate 28.733 5.184

REFERENCES

1. Zhu J. Mammalian cell protein expression for biopharmaceutical production. Biotechnol Adv 2012;30:1158–70. https://doi.org/10.1016/j.biotechadv.2011.08.022
crossref pmid
2. Kim JY, Kim YG, Lee GM. CHO cells in biotechnology for production of recombinant proteins: current state and further potential. Appl Microbiol Biotechnol 2012;93:917–30. https://doi.org/10.1007/s00253-011-3758-5
crossref pmid
3. Montomoli E, Khadang B, Piccirella S, et al. Cell culture-derived influenza vaccines from Vero cells: a new horizon for vaccine production. Expert Rev Vaccines 2014;11:587–94. https://doi.org/10.1586/erv.12.24
crossref
4. Aubrit F, Perugi F, Leon A, et al. Cell substrates for the production of viral vaccines. Vaccine 2015;33:5905–12. https://doi.org/10.1016/j.vaccine.2015.06.110
crossref pmid
5. Genzel Y. Designing cell lines for viral vaccine production: where do we stand? Biotechnol J 2015;10:728–40. https://doi.org/10.1002/biot.201400388
crossref pmid
6. Tan E, Chin CSH, Lim ZFS, Ng SK. HEK293 Cell line as a platform to produce recombinant proteins and viral vectors. Front Bioeng Biotechnol 2021;9:796991. https://doi.org/10.3389/fbioe.2021.796991
crossref pmid pmc
7. Kunitake R, Suzuki A, Ichihashi H, Matsuda S, Hirai O, Morimoto K. Fully-automated roller bottle handling system for large scale culture of mammalian cells. J Biotechnol 1997;52:289–94. https://doi.org/10.1016/S0168-1656(96)01654-9
crossref pmid
8. Chu L, Robinson DK. Industrial choices for protein production by large-scale cell culture. Curr Opin Biotechnol 2001;12:180–7. https://doi.org/10.1016/S0958-1669(00)00197-X
crossref pmid
9. Werner RG, Walz F, Noé W, Konrad A. Safety and economic aspects of continuous mammalian cell culture. J Biotechnol 1992;22:51–68. https://doi.org/10.1016/0168-1656(92)90132-S
crossref pmid
10. Shen CF, Guilbault C, Li X, et al. Development of suspension adapted vero cell culture process technology for production of viral vaccines. Vaccine 2019;37:6996–7002. https://doi.org/10.1016/j.vaccine.2019.07.003
crossref pmid
11. Park S, Kim JY, Ryu KH, et al. Production of a foot-and-mouth disease vaccine antigen using suspension-adapted bhk-21 cells in a bioreactor. Vaccines 2021;9:505. https://doi.org/10.3390/vaccines9050505
crossref pmid pmc
12. Meissner P, Pick H, Kulangara A, Chatellard P, Friedrich K, Wurm FM. Transient gene expression: recombinant protein production with suspension-adapted HEK293-EBNA cells. Biotechnol Bioeng 2001;75:197–203. https://doi.org/10.1002/bit.1179
crossref pmid
13. Lee N, Shin J, Park JH, Lee GM, Cho S, Cho BK. Targeted gene deletion using DNA-free RNA-guided Cas9 nuclease accelerates adaptation of cho cells to suspension culture. ACS Synth Biol 2016;5:1211–9. https://doi.org/10.1021/acssynbio.5b00249
crossref pmid
14. Condreay LD, Aldrich CE, Coates L, Mason WS, Wu TT. Efficient duck hepatitis B virus production by an avian liver tumor cell line. J Virol 1990;64:3249–58. https://doi.org/10.1128/jvi.64.7.3249-3258.1990
crossref pmid pmc
15. Li T, Xie J, Lv L, et al. A chicken liver cell line efficiently supports the replication of ALV-J possibly through its high level viral receptor and efficient protein expression system. Vet Res 2018;49:41. https://doi.org/10.1186/s13567-018-0537-7
crossref pmid pmc
16. Lee CW, Jung K, Jadhao SJ, Suarez DL. Evaluation of chicken-origin (DF-1) and quail-origin (QT-6) fibroblast cell lines for replication of avian influenza viruses. J Virol Methods 2008;153:22–8. https://doi.org/10.1016/j.jviromet.2008.06.019
crossref pmid
17. Khanna M, Kumar P, Choudhary K, Kumar B, Vijayan VK. Emerging influenza virus: a global threat. J Biosci 2008;33:475–82. https://doi.org/10.1007/s12038-008-0066-z
crossref pmid pmc
18. Hammond TG, Hammond JM. Optimized suspension culture: the rotating-wall vessel. Am J Physiol Renal Physiol 2001;281:F12–25. https://doi.org/10.1152/ajprenal.2001.281.1.F12
crossref pmid
19. Ryu JH, Kim MS, Lee GM, Choi CY, Kim BS. The enhancement of recombinant protein production by polymer nanospheres in cell suspension culture. Biomaterials 2005;26:2173–81. https://doi.org/10.1016/j.biomaterials.2004.06.017
crossref pmid
20. van Wielink R, Kant-Eenbergen HCM, Harmsen MM, Martens DE, Wijffels RH, Coco-Marrtin JM. Adaptation of a Madin–Darby canine kidney cell line to suspension growth in serum-free media and comparison of its ability to produce avian influenza virus to Vero and BHK21 cell lines. J Virol Methods 2011;171:53–60. https://doi.org/10.1016/j.jviromet.2010.09.029
crossref pmid
21. Rourou S, Ben Zakkour M, Kallel H. Adaptation of Vero cells to suspension growth for rabies virus production in different serum free media. Vaccine 2019;37:6987–95. https://doi.org/10.1016/j.vaccine.2019.05.092
crossref pmid
22. Renner WA, Jordan M, Eppenberger HM, Leist C. Cell–cell adhesion and aggregation: Influence on the growth behavior of CHO cells. Biotechnol Bioeng 1993;41:188–93. https://doi.org/10.1002/bit.260410204
crossref pmid
23. Pais DAM, Carrondo MJT, Alves PM, Teixeira AP. Towards real-time monitoring of therapeutic protein quality in mammalian cell processes. Curr Opin Biotechnol 2014;30:161–7. https://doi.org/10.1016/j.copbio.2014.06.019
crossref pmid
24. Wu S, Rish AJ, Skomo A, Zhao Y, Drennen JK, Anderson CA. Rapid serum-free/suspension adaptation: medium development using a definitive screening design for Chinese hamster ovary cells. Biotechnol Prog 2021;37:e3154. https://doi.org/10.1002/btpr.3154
crossref pmid
25. Zanghi JA, Renner WA, Bailey JE, Fussenegger M. The growth factor inhibitor suramin reduces apoptosis and cell aggregation in protein-free CHO cell batch cultures. Biotechnol Prog 2000;16:319–25. https://doi.org/10.1021/bp0000353
crossref pmid
26. Li L, Qin J, Feng Q, et al. Heparin promotes suspension adaptation process of CHO–TS28 cells by eliminating cell aggregation. Mol Biotechnol 2011;47:9–17. https://doi.org/10.1007/s12033-010-9306-1
crossref pmid
27. Ritacco FV, Wu Y, Khetan A. Cell culture media for recombinant protein expression in Chinese hamster ovary (CHO) cells: history, key components, and optimization strategies. Biotechnol Prog 2018;34:1407–26. https://doi.org/10.1002/btpr.2706
crossref pmid
28. Sarrazin S, Lamanna WC, Esko JD. Heparan sulfate proteoglycans. Cold Spring Harb Perspect Biol 2011;3:a004952. https://doi.org/10.1101/cshperspect.a004952
crossref pmid pmc
29. Dee KU, Shuler ML, Wood HA. Inducing single-cell suspension of BTI-TN5B1–4 insect cells: I. the use of sulfated polyanions to prevent cell aggregation and enhance recombinant protein production. Biotechnol Bioeng 1997;54:191–205. https://doi.org/ https://doi.org/10.1002/(SICI)1097-0290(19970505)54:3<191::AID-BIT1>3.0.CO;2-A
crossref pmid
30. Tsao YS, Condon R, Schaefer E, Lio P, Liu Z. Development and improvement of a serum-free suspension process for the production of recombinant adenoviral vectors using HEK293 cells. Cytotechnology 2001;37:189–98. https://doi.org/10.1023/A:1020555310558
crossref pmid pmc
31. Tsuyoshi T, Chouhei S, Shuichi KIN, et al. Dextran sulfate suppresses cell adhesion and cell cycle progression of melanoma cells. Anticancer Res 2005;25:895–902.
crossref pmid
32. Wu H, Tang X, Wang Y, et al. Dextran sulfate prevents excess aggregation of human pluripotent stem cells in 3D culture by inhibiting ICAM1 expression coupled with down-regulating E-cadherin through activating the Wnt signaling pathway. Stem Cell Res Ther 2022;13:218. https://doi.org/10.1186/s13287-022-02890-4
crossref pmid pmc
33. Saisud S, Posung M, Tuntigumthon S, Areesirisuk A, Dhepakson P, Teeka J. Development of an animal-derived component-free medium for Spodoptera frugiperda (Sf9) cells using response surface methodology. Biotechnol Lett 2023;45:761–77. https://doi.org/10.1007/s10529-023-03389-5
crossref pmid
34. Park JH, Lim MS, Woo JR, Kim JW, Lee GM. The molecular weight and concentration of dextran sulfate affect cell growth and antibody production in CHO cell cultures. Biotechnol Prog 2016;32:1113–22. https://doi.org/10.1002/btpr.2287
crossref pmid
35. Reinhart D, Damjanovic L, Kaisermayer C, Kunert R. Benchmarking of commercially available CHO cell culture media for antibody production. Appl Microbiol Biotechnol 2015;99:4645–57. https://doi.org/10.1007/s00253-015-6514-4
crossref pmid pmc
36. Pereira S, Kildegaard HF, Andersen MR. Impact of CHO metabolism on cell growth and protein production: an overview of toxic and inhibiting metabolites and nutrients. Biotechnol J 2018;13:1700499. https://doi.org/10.1002/biot.201700499
crossref
37. Bokel C, Brown NH. Integrins in development: moving on, responding to, and sticking to the extracellular matrix. Dev Cell 2002;3:311–21.
crossref pmid
38. Theocharis AD, Skandalis SS, Gialeli C, Karamanos NK. Extracellular matrix structure. Adv Drug Deliv Rev 2016;97:4–27. https://doi.org/10.1016/j.addr.2015.11.001
crossref pmid
39. Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest 2009;119:1420–8. https://doi.org/10.1172/JCI39104
crossref pmid pmc
40. Huhn S, Chang M, Kumar A, et al. Chromosomal instability drives convergent and divergent evolution toward advantageous inherited traits in mammalian CHO bioproduction lineages. iScience 2022;25:104074. https://doi.org/10.1016/j.isci.2022.104074
crossref pmid pmc
41. van der Valk J, Brunner D, De Smet K, et al. Optimization of chemically defined cell culture media-replacing fetal bovine serum in mammalian in vitro methods. Toxicol In Vitro 2010;24:1053–63. https://doi.org/10.1016/j.tiv.2010.03.016
crossref pmid
42. Jang M, Pete ES, Bruheim P. The impact of serum-free culture on HEK293 cells: From the establishment of suspension and adherent serum-free adaptation cultures to the investigation of growth and metabolic profiles. Front Bioeng Biotechnol 2022;10:964397. https://doi.org/10.3389/fbioe.2022.964397
crossref pmid pmc
43. Arthuso FS, Bartolini P, Soares CR. Laboratory production of human prolactin from CHO cells adapted to serum-free suspension culture. Appl Biochem Biotechnol 2012;167:2212–24. https://doi.org/10.1007/s12010-012-9745-1
crossref pmid
TOOLS
METRICS Graph View
  • 1 Crossref
  •  0 Scopus
  • 3,866 View
  • 186 Download
Related articles


Editorial Office
Asian-Australasian Association of Animal Production Societies(AAAP)
Room 708 Sammo Sporex, 23, Sillim-ro 59-gil, Gwanak-gu, Seoul 08776, Korea   
TEL : +82-2-888-6558    FAX : +82-2-888-6559   
E-mail : editor@animbiosci.org               

Copyright © 2026 by Asian-Australasian Association of Animal Production Societies.

Developed in M2PI

Close layer
prev next