All of the procedures involving the care and use of animals were approved by the Institutional Animal Care and Use Committee of Yangzhou University (approval number: SYXK [Su] 2021–0027). The fertilized eggs of Rugao yellow chicken were purchased from the Poultry Research Institute of Chinese Academy of Agricultural Sciences and hatched under the environment of 37°C with 70% humidity.

The freshly fertilized eggs from Rugao yellow chickens were provided by the Poultry Research Institute of CAAS, Yangzhou, Jiangsu Province, China. PGCs were isolated from the genital ridges of chicken embryos incubated for 3.5 days, 4.5 days, 5.5 days respectively and cultured in Dulbecco’s modified eagle medium (21068028; Gibco, Carlsbad, CA, USA) containing 24% H₂O (W3500; Sigma-Aldrich, St. Louis, MO, USA), 0.15 mM CaCl₂ (C7902; Sigma-Aldrich, USA), 1% GlutaMax (35050061; Gibco, USA), 1% non-essential amino acids (11140050; Gibco, USA), 1.2 mM sodium pyruvate (11360070; Gibco, USA), 0.1 mM β-mercaptoethanol (21985023; Gibco, USA), 0.2% chicken serum (16110082; Gibco, USA), 0.2% ovalbumin (A5503; Sigma-Aldrich, USA), 2% B-27 (17504044; Gibco, USA), 1% EmbryoMax Nucleosides (ES-008; Sigma-Aldrich, USA), 0.01% heparin sodium (HY-17567A; MCE, Monmouth Junction, NJ, USA), 25 ng/mL activin A (HY-P70311; MCE, USA), 4 ng/mL FGF-2 (HY-P70600; MCE, USA), 1% penicillin–streptomycin (15140148; Gibco, USA). PGCs were maintained in a 5% CO₂ humidified atmosphere at 37.0°C. The isolation and culture methods for chicken PGCs have been described previously [13].

Chicken embryo blood was added to the reaction solution of Mighty Amp DNA Polymerase (R071A; Takara, Dalian, China). Amplification was performed using CHD1 specific primers (F: CTGCGAGAACGTGGCAACAGAGT; R: ATTGAAATGATCCAGTGCTTG) to identify the sex of the embryos and agarose gel electrophoresis showed two strips at 580 bp and 434 bp for female (ZW) and only one strip at 580 bp for male (ZZ) [14].

Female and male PGCs at E3.5, E4.5, E5.5 were collected and washed with phosphate buffered saline (PBS). Then 1% Triton X-100 was added for 15 min to permeabilize the membrane, and the cells were blocked with 10% fetal bovine serum (FBS) for 2 h. C-KIT antibody was added and incubated at 37°C for 2 h and then at 4°C overnight. The secondary antibody was added after washing the cells three times with PBS-Tween (PBST) and incubated at 37°C for 2 h without light. The cells were resuspended with PBS and detected using flow cytometry (BD LSRFortessa; BD Biosciences, San Jose, CA, USA).

The collected PGCs were resuspended with PAS fixative and dropped onto cell slides to dry in a ventilated area. The cells were washed with distilled water and air-dried, and stained with PAS staining kit (G1360; Solarbio, Beijing, China). The cells were treated with oxidant for 10 min at room temperature and then washed with distilled water and air-dried. Then 20 μL Schiff reagent per slice was used to stain the cells for 15 min away from light, and the cells were washed with sodium sulfite solution and distilled water. After air-dried, the cells were stained with hematoxylin for 2 min.

The collected female and male PGCs at E3.5, E4.5, E5.5 were fixed with 4% paraformaldehyde for 30 min, washed with PBS three times and treated with 1% Triton X-100 for 15 min, followed by the addition of 10% FBS to block the cells for 2 h. Then, the primary antibodies against chicken vasa homologue (CVH) (ab13840; Abcam, Cambridge, MA, USA) and SSEA-1 (ab16285; Abcam, USA) were added and incubated at 37°C for 2 h and then at 4°C overnight. After washing three times with PBST, the cells were incubated with the corresponding secondary antibodies at 37°C for 2 h without light, then washed three times with PBST, followed by incubation with 4’,6-diamidino-2-phenylindole (DAPI) for 10 min without light and then washed. Fluorescence was observed and photographed under the fluorescence microscope (FV1200; Olympus, Tokyo, Japan).

Total RNA was extracted from 2×10⁶ female and male PGCs at E3.5, E4.5, E5.5 and chicken embryonic fibroblasts (CEFs) respectively using TRNzol (DP424; Tiangen, Beijing, China) and reverse transcribed into cDNA with HiScript III RT SuperMix (R323–01; Vazyme, Nanjing, China). ACTB was used as an internal control gene to estimate the expression of CVH and POU5F3 [15–17]. The reaction mixture for quantitative real-time polymerase chain reaction (qRT-PCR) included 10 μL 2×ChamQ Universal SYBR qPCR Master Mix, 0.6 μL each of upstream and downstream primer, 2 μL cDNA and 6.8 μL ddH₂O. The reaction procedure was performed according to the instructions provided by ChamQ Universal SYBR qPCR Master Mix (Q711–02; Vazyme, China). The relative gene expression was calculated with the 2^−ΔΔCt method [18]. The primers are supplied in Supplementary Table S10.

Total RNA was extracted from 5×10⁷ female and male PGCs at E3.5, E4.5, E5.5 using TRNzol (DP424; Tiangen, China). RNA purity and concentration were evaluated with the NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). RNA integrity was assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). The libraries were constructed with VAHTS Universal V6 RNA-seq Library Prep Kit and sequenced on an Illumina Novaseq 6000 platform by Shanghai OE Biotechnology (Shanghai, China). The raw data were quality assessed and filtered by FastQC to obtain high quality and relatively accurate valid data [19]. Gene expression (fragments per kilobase of exon model per million mapped fragments [FPKM] value) was analyzed by Cuffdiff after comparing the valid data of the samples with the reference genome using HISAT2 [20], and differentially expressed genes were screened by p<0.05 and |log2FC| >1. The process and method of gene ontology (GO) [21] and Kyoto encyclopedia of genes and genomes (KEGG) [22] enrichment analysis for differentially expressed genes were referred to relevant studies.

The green fluorescent protein (GFP)⁺ PGCs at E3.5, E4.5, and E5.5 were obtained according to the previous study [23]. When the recipient chicken embryos developed to E2.5 (HH17), a small hole was made at the blunt end of the egg and a window, approximately 1 cm in diameter, was created with forceps. A total of 5,000 GFP⁺ PGCs were injected into the dorsal aorta of the recipient embryo under a stereomicroscope and 20 μL penicillin–streptomycin was dropped into the window. Then the window was sealed with medical breathable tape, and the eggs were put back to the incubator for incubation. The recipient chicken embryos were collected after developing to E7.5 (HH32) and the migration of GFP⁺ PGCs to the gonads was observed under a stereoscopic fluorescence microscope.

Female and male PGCs at E3.5, E4.5, E5.5 were inoculated in 24-well plates with 1×10⁵ per well and labeled with 50 μL of 50 μM EdU medium. Then the cells were fixed with 4% paraformaldehyde, followed by Apollo (C10310–1; RiboBio, Guangzhou, China) staining. Finally, DNA was stained with Hoechst33342 (C10310–1; RiboBio, China) and observed under the fluorescence microscope.

After 5×10⁵ female and male PGCs at E3.5, E4.5, E5.5 were collected and washed with pre-cooled PBS, the cells were respectively incubated with Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI) (40302ES50, Yeasen, Shanghai, China) at room temperature for 15 min without light. The cells were detected by flow cytometry.

All experiments were repeated at least three times, and the data are presented as mean±standard error. After all data sorted by EXCEL, SPSS 19.0 (SPSS, Chicago, IL, USA) and Graph Pad Prism 6 (GraphPad Software Inc., San Diego, CA, USA) were used to perform significance analysis and generate diagrams. Significant differences between the groups were determined by one-sample t-test and one-way analysis of variance (* p<0.05, significant difference. ** p<0.01, extremely significant difference).

To effectively isolate PGCs in vivo, we first analyzed the proportion of PGCs in female and male genital ridges at E3.5, 4.5, and 5.5 by flow cytometry. The results showed that the proportion of PGCs in female and male genital ridges at different developmental time points was very small but different, and there was no significant difference between the proportion of female PGCs and that of male PGCs at the same embryonic age (p>0.05). These preliminarily indicated that PGCs in the early genital ridges have a certain proliferation ability (Supplementary Figure S1B–1D). Subsequently, the female and male PGCs were cultured and purified in vitro using feeder layer-free culture system. Morphological observations showed that the diameter of PGCs was significantly larger than that of somatic cells; during purification culture, the number of somatic cells in the culture medium gradually decreased while the number of PGCs increased significantly, presenting as large single round clones with smooth edges (Figure 1A; Supplementary Figure S1E). The results of cell identification showed that female and male PGCs at different embryonic ages were all positive for PAS, PGC marker protein CVH and stem cell marker protein SSEA-1 (Figure 1B, 1C). The results of qRT-PCR showed that the expression of pluripotency marker gene POU5F3 and PGC marker gene CVH was significantly higher in PGCs than in CEFs (p<0.01) (Figure 1D). These results indicated that high-quality female and male PGCs at different embryonic ages were successfully isolated and obtained.

To systematically identify the differences between female and male PGCs at different embryonic stages, female and male PGCs at different embryonic stages were collected and transcriptome sequencing was performed in this study. p<0.05 and |log2FC| >1 was used as the criterion for differentially expressed genes (DEGs) screening. According to the statistics of the number of DEGs, the number of DEGs between female and male PGCs was higher and increased obviously during development, but the number of DEGs between female and male PGCs at the same developmental time point was lower, showing an increasing trend (Supplementary Figure S2A). To further evaluate the differences between female and male PGCs at different developmental time points, PCA and Pearson’s correlation analysis were conducted, and the results were consistent with the statistical results of DEGs: there were larger differences between PGCs at different embryonic stages and smaller differences between male and female PGCs at the same embryonic stage (Supplementary Figure S2B, 2C).

The allogeneic migration ability of PGCs is fundamental to the application of PGCs in transgenic and breeding fields and is also an important index to evaluate the germline transmission ability in the process of PGC allotransplantation. We compared the migration ability of PGCs at E3.5, E4.5, and E5.5 and found that the number of PGCs at E3.5 that migrated to the gonads was extremely significantly higher than that of PGCs at E4.5 or E5.5 (p<0.01) (Figure 2A, 2B), indicating that PGCs at E3.5 possess stronger migration ability. Therefore, the germline transmission ability of female and male PGCs, especially the migration capacity, was evaluated during development. The results showed that 2,780 genes were screened and identified as DEGs in male PGCs during the development from E3.5 to E4.5, of which 73 DEGs were enriched in 13 (13/62) GO terms related to germline transmission ability, such as spermatogenesis, cell migration (p< 0.1) (Figure 2C, 2E; Supplementary Table S1). Gene expression analysis revealed that the expression of genes related to germline transmission ability was higher than that in E4.5 (Figure 2G; Supplementary Table S2). Specifically, genes related to cell migration ability ADAMTS9, STC1, ITGA4, and PAX6 were significantly down-regulated, probably due to the gradual loss migration ability after colonizing gonads while spermatogenesis-related genes RHBDD1, TDRD9 were up-regulated, indicating that as development progressed PGCs in gonads had begun to prepare for spermatogenesis, in other words, PGCs stored materials for further germline specialization (Figure 2I). During further development (E4.5–E5.5), more DEGs (165) were significantly enriched in 13 GO terms related to germline transmission ability (Figure 2D, 2F; Supplementary Table S1). Gene expression analysis further proved that as development progressed, the germline transmission ability of PGCs declined, with migration-related genes ADGRG3, JAML, ITGA5, and LGR6 down-regulated; meanwhile male germ cells were further specialized, with KIT up-regulated (Figure 2H, 2J; Supplementary Table S3). It is interesting to find that at this time CYP26C1 showed a tendency to highly expressed to inhibit the progression of meiosis, which is an important mechanism to ensure the normal development of early reproduction without entering meiosis in advance. The changes in germline transmission ability during the development of female PGCs were basically consistent with those of male PGCs (Supplementary Figure S3; Supplementary Table S4–S6). Based on the results of these analyses, we conclude that early PGCs are more suitable for in vitro manipulation and allotransplantation.

It is universally acknowledged that the proliferation capacity of cells is critical for long-term culture in vitro. PGCs were collected for EdU proliferation assay. The results showed that the number of EdU⁺ PGCs decreased significantly with development (Figure 3A). To explain this, we compared the differences in cell proliferation capacity of male PGCs during development. Functional annotation was performed on the DEGs screened (2,780 from E3.5 to E4.5 and 6,098 from E4.5 to E5.5), which showed that during the development of PGCs from E3.5 to E5.5, respectively 105 and 314 DEGs were significantly enriched in 14 (14/74, p<0.1) and 32 (32/88, p<0.1) terms related to cell proliferation (Figure 3B, 3C; Supplementary Table S7). Gene expression analysis showed that these genes were significantly down-regulated with the development of male PGCs (p<0.01, p<0.01) (Figure 3D, 3E; Supplementary Table S8, S9), and among these genes, we noticed that the expression of cytokines involved in proliferation regulation such as ACVRL1, TGFB3, VEGFA, AGTR2 were significantly down-regulated (Figure 3F, 3G; Supplementary Table S8, S9). These preliminarily indicated that the proliferation capacity of PGCs is significantly down-regulated. To further identify the changes in proliferation capacity of PGCs during development, 105 and 314 DEGs were enriched for KEGG pathway analysis respectively. The results showed that the key signaling pathways involved in the regulation of cell proliferation during the whole development, such as the Cytokine-cytokine receptor interaction, MAPK signaling pathway, Wnt signaling pathway, and Notch signaling pathway, were significantly enriched, and gene expression analysis showed that these signaling pathways were inhibited to varying degrees with development progressed, consistent with the results of GO analysis (Figure 3H; Supplementary Table S8, S9). Similar characterization of changes in proliferation capacity could also be observed during the development of female PGCs (Supplementary Figure S4). We therefore concluded that PGCs experience loss of proliferation capacity during development (E3.5 to E5.5) in vivo.

Long-term culture or cell line establishment of PGCs in vitro has always been a key difficulty restricting the specific application of PGCs, and the influencing factors not only involve cell proliferation, but also intercellular adhesion as well as information communication in the extracellular matrix. We found that during the development of male PGCs from E3.5 to E4.5 210 DEGs were significantly enriched in 16 GO terms related to cell adhesion and extracellular matrix interactions, and these DEGs were also significantly enriched in signaling pathways related to cell adhesion and extracellular matrix (Figure 4A, 4G). In gene expression analysis, we noticed that the adhesion between PGCs gradually decreased with development, which was confirmed by many down-regulated expressions of members of the collagen and integrin family members (Figure 4C, 4E). During further development of male PGCs we found that the decrease of cell adhesion and extracellular matrix interactions showed an obvious trend of enhancement (394 DEGs), and members of collagen family as well as integrin family were down-regulated to varying degrees similar to the development process before (Figure 3B, 3D, 3F, 3H). Interestingly, signaling pathway enrichment analysis of genes related to cell adhesion throughout the process revealed that signals such as transforming growth factor and vascular endothelial growth factor signaling pathway were enriched to varying degrees, suggesting that these signaling pathways were also involved in the regulation of cell adhesion during the development of PGCs. As is known to all, cell adhesion affects cell proliferation and motor capacity, and the decrease of adhesion performance during PGC development is consistent with the decrease of cell proliferation and migration capacity [24–27]. Similar phenomenon was observed during the development of female PGCs (Supplementary Figure S5). Taken together, we concluded that early PGCs are more suitable for long-term culture and cell line establishment in vitro.

During the comparison of differences between female and male PGCs, we found though with the progress of development the differences between female and male PGCs gradually increased, only a small number of DEGs between female and male PGCs at E3.5 and E4.5 were enriched in related terms such as cell proliferation, germline transmission ability and cell adhesion (Supplementary Figure S6A). Thus, their difference could not be assessed accurately. However, we noticed that at E5.5, female and male PGCs showed different characteristics. Gene expression characteristics showed that male PGCs had better proliferation and germline transmission ability than female PGCs (Supplementary Figure S6A, 6B). Differences in the current culture systems as well as in vitro expansion ability of male and female PGCs can also be explained by these results.

Long-term effective cryopreservation and thawing of PGCs is the key to the application of PGCs in the field of species resource conservation. Currently, the cryopreservation and recovery system for PGCs is immature, so we intended to provide a solution for optimizing the cryopreservation and recovery system from the gene expression level. PGCs at E3.5, E4.5, and E5.5 were frozen respectively and thawed after 30 days, followed by examining their apoptosis levels. The results showed that although PGCs at E5.5 also presented a large amount of apoptosis, their apoptosis levels were significantly lower than those of PGCs at E3.5 and E4.5 (Figure 5). Cell freezing can cause DNA damage, so we focused on different DNA damage repair pathways. The analysis showed that there were no obvious differences in the expression of genes related to repair pathways such as base excision repair (BER), nucleotide excision repair (NER), mismatch repair (MMR) and homologous recombination (HR) during PGC development (Supplementary Figure S8). However, during the development of female and male PGCs we noticed that from E3.5 to E4.5 the expression of DEGs in these pathways fluctuated but the differences were not significant, suggesting that these pathways were not activated in this process (Supplementary Figure S7). Interestingly, during further development of both female and male PGCs, we noted that genes related to BER, NER, MMR and HR pathways were significantly down-regulated, especially XRCC family and POLD family, indicating that compared with female and male PGCs at E3.5 and E4.5, female and male PGCs at E5.5 might possess the higher recovery efficiency after cryopreservation (Figure 6). Based on these results, we concluded that PGCs at late embryonic stage (E5.5) are suitable cell materials for cryopreservation and thawing.