Go to Top Go to Bottom
Anim Biosci > Volume 36(7); 2023 > Article
Park and Kim: Protective effect of Buddha’s Temple extract against tert-butyl hydroperoxide stimulation-induced oxidative stress in DF-1 cells

Abstract

Objective

This study aimed to determine the protective efficacy of Buddha’s Temple (BT) extract against tert-butyl hydroperoxide (t-BHP)-induced oxidative stress in Gallus gallus chicken embryo fibroblast cell line (DF-1) and its effects on the cell lipid metabolism.

Methods

In this experimental study, Gallus gallus DF-1 fibroblast cells were pretreated with BT 10−7 for 24 hours, followed by their six-hour exposure to t-BHP (100 μM). Water-soluble tetrazolium salt-8 (WST-8) assays were performed, and the growth curve was computed. The intracellular gene expression changes caused by BT extract were confirmed through quantitative polymerase chain reaction (qPCR). Flow cytometry, oil red O staining experiment, and thin-layer chromatography were performed for the detection of intracellular metabolic mechanism changes.

Results

The WST-8 assay results showed that the BT pretreatment of Gallus gallus DF-1 fibroblast cell increased their cell survival rate by 1.08%±0.04%, decreased the reactive oxygen species (ROS) level by 0.93%±0.12% even after exposure to oxidants, and stabilized mitochondrial activity by 1.37%±0.36%. In addition, qPCR results confirmed that the gene expression levels of tumor necrosis factor α (TNFα), TIR domain-containing adapter inducing IFN-beta (TICAM1), and glucose-regulated protein 78 (GRP78) were regulated, which contributed to cell stabilization. Thin-layer chromatography and oil red O analyses showed a clear decrease in the contents of lipid metabolites such as triacylglycerol and free fatty acids.

Conclusion

In this study, we confirmed that the examined BT extract exerted selective protective effects on Gallus gallus DF-1 fibroblast cells against cell damage caused by t-BHP, which is a strong oxidative inducer. Furthermore, we established that this extract significantly reduced the intracellular ROS accumulation due to oxidative stress, which contributes to an increase in poultry production and higher incomes.

INTRODUCTION

Oxidative stress is a considerable contributor to the development of various human diseases. However, a number of antioxidant compounds can neutralize excessive free radicals, protect cells from their toxic effects, and prevent or treat diseases. Reactive oxygen and nitrogen species (ROS/RNS) are considered essential for various cell functions [1]. However, increased oxidant levels create an imbalance in the cell redox states that allows oxidative stress to overcome the capacity of the antioxidant defense networks leading to cell damage and even death. Previous reports have confirmed that oxidative stress is involved in the development of various diseases, including diabetes, neurodegeneration, cancer, and atherosclerosis. Although enzyme and non-enzyme defense systems detoxify the ROS/RNS already present in cells and suppress ROS/RNS generation, under certain pathological conditions [2] antioxidant defense systems are not able to offset the toxic effects of amplified oxidative stress [3,4]. This protective inability is due to the unavailability of a defense system against the harmful effects of oxidizing accelerators.
Therefore, targeting the imbalance of intracellular oxidant and antioxidant agents is an appropriate approach for the treatment of various secondary complications associated with oxidative stress-related diseases and disorders [5]. Enhancing the levels of exogenous antioxidants or activities can be effective as a therapeutic approach against the overproduction of ROS/RNS [6]. Reactive oxygen species are generated in the process of energy production necessary for maintaining life by using oxygen from the air [7]. Reactive oxygen species are known to directly or indirectly cause damage to the body by their involvement in a wide range of biological activities. Singlet oxygen (1O2) is produced by the reduction of triplet oxygen (3O2), which is the most stable form of this element [8,9]. If this oxidative stress persists, it damages DNA, causing cancer; unsaturated fatty acids are attacked, which are components of cell bio-membranes, and a peroxidation reaction is induced, leading to the accumulation of lipid peroxide in the body, resulting in skin aging, arteriosclerosis, stroke, diabetes, and tumor development [1013]. Tert-butyl hydroperoxide (t-BHP) is an environmental toxicant widely used as an oxidative stress inducer that triggers ROS production under many conditions and stimulates cell death [14]. Due to the characteristics of t-BHP, it is widely used in simulation studies as an inducer of oxidative stress. After t-BHP penetration through the cell membrane, it is easily decomposed into alkoxyl and peroxyl radicals, generating ROS that cause damage to proteins, nucleic acids, and cell membranes, and promote lipid peroxidation, cytotoxicity, and apoptosis [15,16]. Antioxidant dietary supplements have received considerable attention due to their ability to combat the damage caused by oxidative stress. Research is ongoing on the potential application of antioxidants derived from natural sources as an adjuvant treatment of oxidative stress-caused disorders. In this regard, antioxidant effects and anticancer effects of natural bioactive compounds isolated from succulents have been reported [17,18].
In this study, we found that the Crassula ‘Buddha’s Temple (BT)’ extract from the succulent plant Crassaceae could maintain ROS, Mitochondria homeostasis and regulate lipid levels. The anti-inflammatory effects and mechanisms of action and the expression patterns of the bioactive substances in chicken embryo fibroblast cell line (DF-1) cells were previously investigated [19]. Our results can contribute to better understanding the response to BT treatment and the related gene expression in chicken fibroblast cells, and furthermore, through the resolution of lipid accumulation generated by stress in chicken fibroblast cells, improvement of muscle content, increase in body weight, and production of healthy chicken. Based on the effect, it presents the grounds that can contribute to the improvement of productivity of farm households.

MATERIALS AND METHODS

Preparation of Buddha’s Temple extract

Buddha’s Temple was mixed with 30 g of distilled water (DW) and extracted in an autoclave (Daihan Scientific, Wonju, Korea) at 110°C and 39.23 kPa for 15 minutes. Then, the aqueous phase was collected and filtered using a 0.22-μm cellulose-acetate filter (16534-K; Sartorius, Goettingen, Germany).

Cell culture conditions

Gallus gallus DF-1 fibroblast cells were purchased from the American Type Culture Collection and supplemented with 10% (v/v) fetal bovine serum (TMS-013-BKR; Millipore, Burlington, MA, USA) and Dulbecco’s modified eagles medium supplemented with penicillin streptomycin (DMEM; 10–013-CVR; Corning, Corning, NY, USA) in a CO2 incubator (95% air and 5% CO2, 36.5°C).

Treatment conditions and cell viability analysis

After culturing Gallus gallus DF-1 fibroblast cells, they were sub-cultured with 0.25% trypsin-ethylenediaminetetraacetic acid, inoculated into a 96-well plate (1×103 cells/cm2), and cultured for 24 hours. The cells were pretreated with BT 10−7 dissolved in dH2O and incubated with t-BHP at a concentration of 10 μM for 6 hours. This experiment consisted of vehicle, BT 10−7, t-BHP 10 μM, and BT 10−7 + t-BHP 10 μM treatments.
To measure cell viability, water-soluble tetrazolium salt (WST)-8 cell viability assay and growth curve analysis were performed as previously described [4]. Briefly, (1×103) DF-1 cells were seeded in a 96-well cell culture plate (SPL Life Sciences, Pocheon, Korea). To determine cell viability, WST-8 reagent (EZ Cytox Cell Viability Assay Kit; DoGenBio, Seoul, Korea) was added to each well, and the absorbance was measured at 450 nm using a microplate reader (Multi mode microplate reader, FilterMax F3).

Quantitative real-time polymerase chain reaction

Total RNA extraction was performed using TRIzol reagent (15596018; Invitrogen, Carlsbad, CA, USA) following to the manufacturer’s instructions. cDNA was generated using the WizScript cDNA Synthesis Kit (W2202; Wizbiosolutions, Seongnam, Korea) with oligo-dT primer. Quantitative polymerase chain reaction (qPCR) next was performed using a Step OnePlus RT-PCR system (Applied Biosystems, Foster City, CA, USA) with specific primers (Table 1) and SYBR Green qPCR Mix (DQ485; BioFACT, Daejeon, Korea). The cycle threshold (Ct) value was confirmed using Step One software version 2.3 (Applied Biosystems, USA), and the mRNA fold-change value was determined using the 2 (−ΔΔCt) method [20].

Thin-layer chromatography

Total lipid extraction was performed using the Bligh and Dyer method [21]. Briefly, an average of 1×106 cells were lysed in water/chloroform/methanol = 1:2:0.8 (v/v/v) for 12 h at 4°C and then in water/chloroform/methanol = 2:2. The 1.8 (v/v/v) chloroform layer was concentrated for 1 hour at 4°C using a Speed Vac (EYELA, Kouto-Ku, Tokyo, Japan) and plated on a silica gel preparative thin-layer chromatography (TLC) plate (P46021; Analtech, Newark, DE, USA). TLC plates were developed in a solvent system of cyclohexane/ethyl acetate acid = 1:2 (v/v), and the lipids were visualized by incubation with 10% (v/v) sulfuric acid at 120°C. Real-time densitometry was performed, and the Rf value was established to determine the lipid type.

Lipid staining and concentration measurement

Oil red O was used for lipid staining with minor modifications as previously described [6]. Briefly, 1×106 Gallus gallus DF-1 fibroblast cells were seeded in a 60 mm cell culture dish. After 12 hours, the cells were pretreated with BT 10−7 for 24 hours and incubated for 6 hours with t-BHP (100 μM). Then, the cells were washed with phosphate buffered saline, fixed in 3.8% formaldehyde for 15 minutes, washed with 60% (v/v) isopropanol, air-dried, and oil red O stained (Sigma Aldrich, St Louis, MO, USA; 0.2-μm filtration, 0.3% [w/v] after washing 60% [v/v]) isopropanol-stained cells with DW, the oil red O staining was examined using a DMi8 fluorescence microscope (Leica, Deerfield, IL, USA), images were taken with LAS X (Leica, USA) and processed with Photoshop and the CC 2018 program.

Data analysis and statistics

All results were obtained from three independent replicates (biological conditions, n = 3) and expressed as mean±standard deviation. Analysis was performed using GraphPad PRISM software version 9.4.1 (GraphPad Software, San Diego, CA, USA) and Microsoft Excel for Microsoft 365 MS (build 16.0. 14527.20270) (Microsoft, Redmond, WA, USA). The p-value was calculated using the method indicated in the figure legend p<0.05 was considered to indicate a statistically significant difference.

RESULTS

Crassula ‘Buddha’s Temple’ hot water extraction

Buddha’s Temple was washed with DW, cut into 2 to 3 cm pieces, mixed with dH2O at a BT: dH2O ratio of 1:3, and extracted with high-temperature and high-pressure hot water for 15 minutes at 110°C and 39.23 kPa. The BT residue was removed, and a BT extract was prepared by sterilization filtration through a 0.22-μm pore size filter (Figure 1).

Verification of DF-1 cytoprotective efficacy of Buddha’s Temple extract

We investigated the effects of the concentration of the BT extract on the cell viability. A WST-8 assay was performed to determine the range to be used in the experiment. The determination of the cytoprotective efficacy of the BT extract on Gallus gallus DF-1 fibroblast cells confirmed that an optimal cell viability was achieved at a concentration of 10−7. Therefore, in this study, 10−7 was selected as the optimal concentration for measuring the cytoprotective effect of the BT extract (Figure 2A), and this concentration was applied in all subsequent experiments.

Measurement of the viability of DF-1 cells treated with different t-BHP concentrations

The dose-response relationship between the viability of the DF-1 cells and the potent pro-oxidant t-BHP was evaluated. The effect of each concentration (10, 25, 50, and 100 μM) of t-BHP on Gallus gallus DF-1 fibroblast cells for 24 hours was assessed by WST-8 assays. We observed a t-BHP treatment-induced reduction in the viability of the Gallus gallus DF-1 fibroblast cells in a concentration-dependent manner; 100 μM of t-BHP, which induced optimal cell death, was used in our subsequent experiments (Figure 2B).

Verification of the protective effect of the Buddha’s Temple extract against t-BHP-induced cytotoxicity

To investigate the cytoprotective effect of BT extract against t-BHP-induced damage to Gallus gallus DF-1 fibroblast cells, the previously identified BT was added to the treated cells at a concentration of 10−7, and after incubation for an additional 24 hours, treatment with 100 μM of t-BHP was conducted for 6 hours. Then, cell viability was measured by WST-8 assay. Under the experimental conditions, BT increased cell viability, and the cell viability damage by t-BHP was significantly reduced by 0.70%±0.16% compared to 1.08%±0.04% by BT treatment (Figure 2C). The cell viability in the BT treatment (10−7) in Gallus gallus DF-1 fibroblast cells was confirmed using an optical microscope, and no morphological differences were observed (Figure 2D).

Buddha’s Temple reduces t-BHP-induced ROS production in DF-1 cells

To measure the changes in the intracellular ROS production, we examined the effect of BT on the ROS production in Gallus gallus DF-1 fibroblast cells treated with BT and t-BHP by flow cytometry using 2’,7’-dichlorodihydrofluorescein diacetate (DCF-DA). Our results confirmed that a concentration of 100 μM of t-BHP promoted ROS production in DF-1 cells, whereas BT extract inhibited the production of ROS (Figure 3A).

Buddha’s Temple attenuates t-BHP-induced excessive mitochondrial stress in DF-1 cells

Mitochondria are essential for maintaining cell life activities and play an important role in regulating apoptosis that occurs during membrane permeability assessment [22]. They are critically important for cell survival, energy production, and ROS generation, which makes mitochondria one of the main targets for cancer treatment [23]. It is known that oxidative stress induces excessive activation of mitochondria, resulting in mitochondrial stress, leading to apoptosis [24]. To establish whether BT treatment affects homeostasis mechanisms such as mitochondrial activity stabilization, we measured the mitochondrial activity and confirmed the related gene expression changes. The mitochondrial activity was measured by flow cytometry analysis using MitoTracker Deep Red (MTDR; Thermo Fisher Scientific, Waltham, MA, USA). Although excessive mitochondrial activity was induced by t-BHP treatment, our results confirmed that BT attenuated the excessive mitochondrial stress induced by t-BHP in DF-1 cells (Figure 3B).

Buddha’s Temple stabilizes the t-BHP treatment-induced mRNA expression level change

Oxidative stress can affect the expression levels of antioxidant genes. A number of diseases occur when ROS production exceeds a threshold up to which control is exerted by the antioxidant defense system. To further investigate the molecular mechanism of the neuroprotective effect of BT against oxidative damage induced by t-BHP, we investigated the mRNA expression of BT and t-BHP in DF-1 cells by qPCR.
Among the intracellular phenomena associated with oxidative damage, the expression of inflammatory genes of commonly known inflammation-related genes (tumor necrosis factor-alpha [TNFα] and TIR domain-containing adapter inducing IFN-beta [TICAM1]) was analyzed (Figure 4A), and the level of glucose-regulated protein 78 (GRP78), an endoplasmic reticulum (ER) stress factor, was evaluated. The expression of was confirmed (Figure 4B). In addition, the expression levels of cell death-related genes (B-cell lymphoma 2 [Bcl-2], apoptotic protease-activating factor 1 [APAF1]) (Figure 4C) and oxidative phosphorylation-related OXPHOS complex (NADH dehydrogenase (ubiquinone) 1 beta subcomplex assembly factor 8 [NDUFB8]) genes were determined (Figure 4D). Our results confirmed that BT effectively reduced the t-BHP-increased mRNA expression level of all gene expression patterns in DF-1 cells. Therefore, we confirmed that a cell protective effect was exerted by reducing cell damage.

Buddha’s Temple downregulates the neutral lipid content in DF-1 cells

Fat accumulation is a key feature of diabetic kidney disease pathogenesis that is attributed to excessive lipid accumulation (hyperlipidemia) [25]. Renal lipotoxicity is characterized by the accumulation of excessive amounts of intracellular free fatty acids (FFAs) leading to the accumulation of potentially toxic metabolites such as diacylglycerol and ceramide [26]. Kidney damage induced by lipid accumulation occurs through several mechanisms, including the production of ROS and the release of proinflammatory and profibrotic factors [27]. In addition, the elevated levels of ROS affect the homeostasis of the intracellular lipid metabolism, interfering with lipid synthesis and degradation processes [28]. An increase in the ROS level decreases the mitochondrial activity and fatty acid oxidative degradation level, while neutral lipid aggregation and triglyceride production is promoted [29].
To assess the intracellular lipid droplet production, oil red O staining, which is known to react with neutral fats, was performed, and the effect of BT on neutral lipid production in DF-1 cells was established by qPCR and TLC (Figure 5C). High lipid levels lead to excessively elevated ROS amounts, resulting in cellular damage.
The TLC was performed to confirm the change in the lipid content caused by the pre-BT t-BHP treatment. The t-BHP treatment of DF-1 cells increased triacylglycerol (TAG) by 2.67%±0.15% and FFA by 2.17%±0.53% compared to the respective levels in the vehicle treatment. After pretreatment with BT, when t-BHP was treated, TAG was 1.45%±0.55% and FFA 1.54%±0.35% compared to vehicle, and the expression of excessively produced neutral lipids by t-BHP was suppressed (Figure 5A,5B).

DISCUSSION

In this study, the ability of BT to protect cells from t-BHP-induced oxidative damage was investigated in DF-1 cells. We found that BT strongly reduced t-BHP-induced cytotoxicity and apoptosis. In addition, BT efficiently prevented t-BHP-induced mitochondrial dysfunction and oxidation of biomolecules in DF-1 cells. More specifically, it considerably suppressed the t-BHP-induced ROS overproduction in DF-1 cells. These results suggest that BT can protect DF-1 cells from t-BHP-induced cell damage by enhancing the activities of the endogenous enzyme antioxidant defense system.
In addition, mitochondria, the major intracellular ROS producers, are paradoxically sensitive to oxidative stress. Redox damage can easily lead to mitochondrial dysfunction by inhibiting mitochondrial enzymes involved in ATP production [30]. The disruption of oxidative phosphorylation directly affects the respiratory chain electron flux and reduces mitochondrial membrane permeability. Accompanied by increased electron leak in the mitochondrial respiratory chain, enhancing ROS production can put cells at risk of damage [31]. Destructive feedback loops in cells can be created, which can lead to the activation of intrinsic apoptotic pathways. Mitochondrial dysfunction, ROS overproduction, and increased cell death rates are important factors associated with pathological processes in humans and economically important domestic animals. In this study, we evidenced that the negative effects caused by lipid accumulation in fibroblast cells, as well as ROS and mitochondrial dysfunction generated after inducing strong oxidative stress in DF-1 cells, were reduced by BT pre-treatment.
Specifically, the t-BHP-treated DF-1 cells had increased expression of apoptosis genes (Bcl-2 4.16%±3.06%) and upregulated oxidative stress-related enzymes inflammation genes (TNFα, 120.02%±0.15%; TICAM1, 22.64%±17.70%), ER stress gene (GRP78, 2.89%±0.64%), cell death gene (Bcl2, 4.16%±3.06%; APAF1, 2.17%±0.77%), and OXPHOS complex gene (NDUFB8, 13.83%±16.89%). The expression levels of these genes in the BT + t-BHP treatment were considerably lower than those in the vehicle treatment (TNFα, 2.39± 0.99; TICAM1, 0.03%±0.01%; GRP78, 0.23%±0.09%; Bcl2, 0.43%±0.13%; APAF1, 0.03%±0.00%; NDUFB8, 0.65%± 0.08%). The results showed that the mitochondrial activity and fatty acid oxidative degradation levels were reduced along with the decrease in the ROS levels increased by the BT treatment. These results confirm that BT downregulates lipid accumulation by regulating the antioxidant, anti-apoptosis, and anti-inflammation capacity of DF-1 cells, which is a mechanism for the alleviation of t-BHP-induced oxidative stress damage.

Notes

CONFLICT OF INTEREST

We certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript.

FUNDING

This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF), funded by the Ministry of Education (2021R1F1A 1049562). This study was carried out with the support of the R&D Program for Forest Science Technology (Project No. 2021374C10-2123-BD02) provided by the Korea Forest Service (Korea Forestry Promotion Institute).

Figure 1
(A) The appearance of Buddha’s Temple. (B) The manufacturing process of the Buddha’s Temple extract. Buddha’s Temple stems and roots were washed with DW and cut into 2 to 3-cm long pieces. Then, 138 g of Buddha’s Temple stem and 414 mL of DW were added, and high-pressure hot water extraction was conducted for 15 minutes at 39.23 kPa and 110°C. Finally, to produce Buddha’s Temple extract, Buddha’s Temple stem and root were next removed and sterilized using a filter with a 0.22-μm pore size.
ab-23-0014f1.jpg
Figure 2
Effect of BT on the DF-1 cell damage induced by t-BHP. (A) Determination of the effects of various concentrations of Buddha’s Temple on DF-1 cells. The cell count (%) data are expressed as mean±SD. * p<0.05, ** p<0.01, *** p<0.001, *** p<0.0001 by two-way ANOVA with Tukey’s multiple comparison test. (B) Cell viability in DF-1 cells exposed to t-BHP for 6 hours (* p<0.05, ** p<0.01, ** p<0.001, ** p<0.001 by two-way ANOVA with Tukey’s multiple comparison test). (C) BT 10−7 cell viability analysis after 24-hour incubation in an incubator followed by 6-hour exposure to 10 Mm of t-BHP (* p<0.05 by two-way ANOVA with Tukey’s multiple comparison test.). (D) Microscopic observational morphological images of DF-1 cells exposed to t-BHP for 6 hours. The data are expressed as mean±SD. BT, Buddha’s Temple; DF-1, chicken embryo fibroblast cell line; t-BHP, tert-butyl hydroperoxide; ANOVA, analysis of variance; SD, standard deviation.
ab-23-0014f2.jpg
Figure 3
BT reduces the intracellular t-BHP-induced ROS levels in DF-1 cells. (A) After culturing in BT10−7 for 24 hours, the DF-1 cells were exposed to t-BHP for 6 hours, and the changes in the ROS levels were determined using flow cytometry with H2 DCFDA; * p<0.05 by two-way ANOVA with Tukey’s multiple comparison test. (B) After culturing in BT10−7 for 24 hours, the changes in the intracellular mitochondrial levels in DF-1 cells exposed to t-BHP for 6 hours were determined using MTDR dye. The values in the graph are expressed as mean±SD. BT, Buddha’s Temple; t-BHP, tert-butyl hydroperoxide; ROS, reactive oxygen species; DF-1, chicken embryo fibroblast cell line; H2 DCFDA, 2’,7’-dichlorodihydrofluorescein diacetate; ANOVA, analysis of variance; SD, standard deviation. The 24-hour BT treatment was followed by 6-hour t-BHP exposure; * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001 by two-way ANOVA with Tukey’s multiple comparison test.
ab-23-0014f3.jpg
Figure 4
BT pretreatment regulates mRNA expression changes after t-BHP treatment. (A)–(E) DF-1 cells treated with BT for 24 hours and then exposed to t-BHP for 6 hours; the mRNA expression of the genes related to glycolysis was confirmed. BT, Buddha’s Temple; t-BHP, tert-butyl hydroperoxide; DF-1, chicken embryo fibroblast cell line. * p<0.05, ** p<0.01 *** p<0.001, **** p<0.0001 by two-way analysis of variance; with Tukey’s multiple comparison test.
ab-23-0014f4.jpg
Figure 5
BT downregulates the neutral lipid content in DF-1 cells. (A) TLC of neutral lipids in DF-1 cells incubated with BT 10−7 for 24 hours. (B) Densitometry of TAG and FFA. Data are expressed as mean±SD. (C) The lipid accumulation of BT-treated cells was observed microscopically after 6-h exposure to t-BHP. BT, Buddha’s Temple; DF-1, chicken embryo fibroblast cell line; TLC, thin-layer chromatography; TAG, triacylglycerol; FFA, free fatty acid; SD, standard deviation; ANOVA, analysis of variance. * p<0.05, ** p<0.01 *** p<0.001, **** p<0.0001 by two-way ANOVA with Tukey’s multiple comparison test.
ab-23-0014f5.jpg
Table 1
Lists of primers used to perform quantitative polymerase chain reaction
Target gene (accession number of NCBI) Primer type 5′ to 3′ Sequence
TNFa (MF000729.1) Forward GGTTCGAGTCGCTGTATCAGG
Reverse ACTCCCACCACCCCAAAATA
TICAM1 (NM_001081506.1) Forward CACATCTGCTCAGGTGGGTC
Reverse GGATGATGATGGAACGGGCA
Bcl-2 (NM_205339.2) Forward GGATGGGATGCCTTTGTGGA
Reverse AGAGTGATGCAAGCTCCCAC
APAF1 (XM_416167.6) Forward GGACGACAGCCTTTTCCTGA
Reverse TCTTTGAGCCCGTAGCTTGG
GRP78 (NM_205491.1) Forward TCGGCTAACACCAGAGGAGA
Reverse CGGGCATCAATGCGTTCTTT
NDUFB8 (NM_001006502.1) Forward GTGGGACCGAAGCAGTATCC
Reverse CGGTGGCTCTTTATTGGGGT

TNF a, tumor necrosis factor-alpha; TICAM1, TIR domain-containing adapter inducing IFN-beta; Bcl-2, B-cell lymphoma 2; APAF1, apoptotic protease-activating factor 1; GRP78, glucose-regulated protein 78; NDUFB8, NADH dehydrogenase (ubiquinone) 1 beta subcomplex assembly factor 8.

REFERENCES

1. Singh S, Singh DK, Meena A, Dubey V, Masood N, Luqman S. Rutin protects t-butyl hydroperoxide-induced oxidative impairment via modulating the Nrf2 and iNOS activity. Phytomedicine 2019;55:92–104. https://doi.org/10.1016/j.phymed.2018.07.009
crossref pmid
2. Chen XL, Kunsch C. Induction of cytoprotective genes through Nrf2/antioxidant response element pathway: a new therapeutic approach for the treatment of inflammatory diseases. Curr Pharm Des 2004;10:879–91. https://doi.org/10.2174/1381612043452901
crossref pmid
3. Manna C, Patrizia G, Valeria C, Ornella M, Arturo L, Vincenzo Z. The protective effect of the olive oil polyphenol (3, 4-Dihydroxyphenyl)-ethanol counteracts reactive oxygen metabolite–induced cytotoxicity in Caco-2 cells. J Nutr 1997;127:286–92. https://doi.org/10.1093/jn/127.2.286
crossref pmid
4. Zhao K, Luo G, Giannelli S, Szeto HH. Mitochondria-targeted peptide prevents mitochondrial depolarization and apoptosis induced by tert-butyl hydroperoxide in neuronal cell lines. Biochem Pharmacol 2005;70:1796–806. https://doi.org/10.1016/j.bcp.2005.08.022
crossref pmid
5. Kennedy CH, Church DF, Winston GW, Pryor WA. Tert-Butyl hydroperoxide-induced radical production in rat liver mitochondria. Free Radic Biol Med 1992;12:381–7. https://doi.org/10.1155/2014/752506
crossref pmid
6. Rashid K, Sil PC. Curcumin ameliorates testicular damage in diabetic rats by suppressing cellular stress-mediated mitochondria and endoplasmic reticulum-dependent apoptotic death. Biochim Biophys Acta Mol Basis Dis 2015;1852:70–82. https://doi.org/10.1016/j.bbadis.2014.11.007
crossref
7. Beckman KB, Ames BN. The free radical theory of aging matures. Physiol Rev 1998;78:547–81. https://doi.org/10.1152/physrev.1998.78.2.547
crossref pmid
8. Young IS, Woodside JV. Antioxidants in health and disease. J Clin Pathol 2001;54:176–86. https://doi.org/10.1136/jcp.54.3.176
crossref pmid pmc
9. Halliwell B, Gutteridge JMC, Aruoma OI. The deoxyribose method: A simple “test-tube” assay for determination of rate constants for reactions of hydroxyl radicals. Anal Biochem 1987;165:215–9. https://doi.org/10.1016/0003-2697(87)90222-3
crossref pmid
10. Fumuali I, Yoko S, Tomoyukt I. Measurement and clinical significance of lipid peroxidation as a biomarker of oxidative stress: oxidative stress in diabetes, atherosclerosis, and chronic inflammation. Antioxidants 2019;8:72. https://doi.org/10.3390/antiox8030072
crossref pmid pmc
11. Pellegrini M, Baldari CT. Apoptosis and oxidative stress-related diseases: the p66Shc connection. Curr Mol Med 2009;9:392–8. https://doi.org/10.2174/156652409787847254
crossref pmid
12. Malle E, Marsche G, Arnhold J, Davies MJ. Modification of low-density lipoprotein by myeloperoxidase-derived oxidants and reagent hypochlorous acid. Biochim Biophys Acta Mol Cell Biol Lipids 2006;1761:392–415. https://doi.org/10.1016/j.bbalip.2006.03.024
crossref
13. Kamat JP. Peroxynitrite: a potent oxidizing and nitrating agent. Indian J Exp Biol 2006;44:436–47.
crossref pmid
14. Masaki N, Kyle ME, Farber JL. tert-Butyl hydroperoxide kills cultured hepatocytes by peroxidizing membrane lipids. Arch Biochem Biophys 1989;269:390–9. https://doi.org/10.1016/0003-9861(89)90122-7
crossref pmid
15. Alía M, Ramos S, Mateos R, Bravo L, Goya L. Response of the antioxidant defense system to tert-butyl hydroperoxide and hydrogen peroxide in a human hepatoma cell line (HepG2). J Biochem Toxicol 2005;19:119–28. https://doi.org/10.1002/jbt.20061
crossref
16. Jung WK, Park SB, Yu HY, Kim YH, Kim J. Antioxidant efficacy of esculetin against tert-butyl hydroperoxide-induced oxidative stress in HEK293 cells. Curr Issues Mol Biol 2022;44:5986–94. https://doi.org/10.3390/cimb44120407
crossref pmid pmc
17. Kim H, Jeon EH, Park BC, Kim SJ. Dudleya brittonii extract promotes survival rate and M2-like metabolic change in porcine 3D4/31 alveolar macrophages. Asian-Australas J Anim Sci 2019;32:1789–800. https://doi.org/10.5713/ajas.19.0251
crossref pmid pmc
18. Kim H, Hwang E, Park BC, Kim SJ. Novel potential NOX2 inhibitors, Dudleya brittonii water extract and polygalatenoside A inhibit intracellular ROS generation and growth of melanoma. Biomed Pharmacother 2022;150:112967. https://doi.org/10.1016/j.biopha.2022.112967
crossref pmid
19. Lee RH, Lee S, Kim YR, Kim SJ, Lee HK, Song KD. Molecular characterization and expression of a disintegrin and metalloproteinase with thrombospondin motifs 8 in chicken. Asian-Australas J Anim Sci 2018;31:1366–72. https://doi.org/10.5713/ajas.18.0265
crossref pmid pmc
20. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001;25:402–8. https://doi.org/10.1006/meth.2001.1262
crossref pmid
21. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Physiol 1959;37:911–7. https://doi.org/10.1139/o59-099
crossref pmid
22. Armstrong JS. Mitochondria: a target for cancer therapy. Br J Pharmacol 2006;147:239–48. https://doi.org/10.1038/sj.bjp.0706556
crossref pmid pmc
23. Fulda S, Galluzzi L, Kroemer G. Targeting mitochondria for cancer therapy. Nat Rev Drug Discov 2010;9:447–64. https://doi.org/10.1038/nrd3137
crossref pmid
24. Jeong JS, Piao Y, Kang S, et al. Triple herbal extract DA-9805 exerts a neuroprotective effect via amelioration of mitochondrial damage in experimental models of Parkinson’s disease. Sci Rep 2018;8:15953. https://doi.org/10.1038/s41598-018-34240-x
crossref pmid pmc
25. Zhang C, Shao M, Yang H, et al. Attenuation of hyperlipidemia- and diabetes-induced early-stage apoptosis and late-stage renal dysfunction via administration of fibroblast growth factor-21 is associated with suppression of renal inflammation. PloS one 2013;8:e82275. https://doi.org/10.1371/journal.pone.0082275
crossref pmid pmc
26. Bobulescu IA. Renal lipid metabolism and lipotoxicity. Curr Opin Nephrol Hypertens 2010;19:393–402. https://doi.org/10.1097/MNH.0b013e32833aa4ac
crossref pmid pmc
27. Chen C, Meng Z, Zheng Y, Hu B, Shen E. Fibroblast growth factor 21 inhibition aggravates cardiac dysfunction in diabetic cardiomyopathy by improving lipid accumulation. Exp Ther Med 2018;15:75–84. https://doi.org/10.3892/etm.2017.5375
crossref pmid
28. Liu L, Zhang K, Sandoval H, et al. Glial lipid droplets and ROS induced by mitochondrial defects promote neurodegeneration. Cell 2015;160:177–90. https://doi.org/10.1016/j.cell.2014.12.019
crossref pmid pmc
29. Smirne C, Croce E, Benedetto DD, et al. Oxidative stress in non-alcoholic fatty liver disease. Livers 2022;2:30–76. https://doi.org/10.3390/livers2010003
crossref
30. Sun C, Nile SH, Zhang Y. Novel insight into utilization of flavonoid glycosides and biological properties of saffron (Crocus sativus L.) flower byproducts. J Agric Food Chem 2020;68:10685–96. https://doi.org/10.1021/acs.jafc.0c04076
crossref pmid
31. Ye H, Luo J, Hu D, et al. Total flavonoids of crocus sativus petals release tert-butyl hydroperoxide-induced oxidative stress in BRL-3A cells. Oxid Med Cell Longev. 2021. 2021:Article ID 5453047. https://doi.org/10.1155/2021/5453047
crossref
TOOLS
METRICS Graph View
  • 3 Web of Science
  • 3 Crossref
  • 2 Scopus
  • 5,242 View
  • 126 Download
Related articles


Editorial Office
Asian-Australasian Association of Animal Production Societies(AAAP)
Room 708 Sammo Sporex, 23, Sillim-ro 59-gil, Gwanak-gu, Seoul 08776, Korea   
TEL : +82-2-888-6558    FAX : +82-2-888-6559   
E-mail : editor@animbiosci.org               

Copyright © 2026 by Asian-Australasian Association of Animal Production Societies.

Developed in M2PI

Close layer
prev next