All procedures for the care and use of pigs were approved by the animal ethics committee of Zhejiang Academy of Agricultural Science, China. We selected 25 male DYL (Duroc×Yorkshire×Landrace) newborn piglets from five litters (five pigs each litter) fed in Lvjia Yuan Livestock Industry Co., Ltd, Zhejiang Province, China. According to the nutritional requirement recommended by NRC (1998), these pigs were creep fed after birth with a creep diet, and weaned on day 28, successively fed until 180-day age. All pigs were housed in a barn with enough space and given a free choice access to diets and tap water. In order to reveal the effects of postnatal growth stages on MyHC expression, we selected several key ages including postnatal 7 days (2.50±0.15 kg, representing the primary stage of piglets), 30 days (10.00±0.50 kg, representing the beginning of weaning stage), 60 days (20.00±0.55 kg, representing the last nursing stage), 120 days (60.00±0.45 kg, representing the end of growing stage) and 180 (100.00±0.60 kg, representing the end of finishing stage) days, and five pigs of each stage were slaughter and sampled. These stages can reflect the changing physiological and in vitro environment of pigs during postnatal growth process, including muscle fiber characteristics.

According to the commercial live pig slaughtering rules in China, the pigs ready for slaughter were kept off feed and given a free access to tap water for 16 hours, and then killed through electrical stunning and exsanguination. About 5-cm-thick longissimus muscle (LM) adjacent to the last rib was collected from the left side of the carcass within 30 min after exsanguination, and was rapidly frozen in liquid nitrogen and then stored in −80°C until analysis.

Myosion protein was extracted as described by Savolainen et al. (1995). About 200-mg LM tissue from each pig was powered in liquid nitrogen, and oscillated while added to 1.4 mL buffer solution pH 6.5 containing 0.3 M KCl, 0.1 M KH₂PO₄, 0.05 M K₂HPO₄, 0.04 M ethylenediaminetetraacetic acid disodium salt. The extracted mix was placed in ice bath for 15 min, and the supernatant was collected by centrifuging at 3,000×g for 10 min at 4°C. A 100-μL aliquot of supernatant was taken to measure total protein concentration with a protein assay kit (micro BCA, Shanghai Sangon Biological Engineering Technology and Services Co., Ltd., Shanghai, China).

The concentration of each MyHC was determined by an USCNLIFETM ELISA kit produced by Wuhan EIAab Technology Co., Ltd, Wuhan, China. The recombinant protein of each MyHC with different concentrations (0, 15, 30, 60, 120, 240, 480, and 960 pg/mL) as a quality control was used to establish a linear regression equation for a quantitative assay. 100-μL supernatant or the quality controls and 50 μL labeling mouse anti-pig IgG with horseradish peroxides were successively added into 96- well micro plate coated by specific antibody (MyHC I: A4.840, sc-53089; MyHC IIa: A4.1519, sc-53094; MyHC IIx: A4.1025, sc-53088; MyHC IIb: MY-32, Sc-58797). The micro plate was incubated for 1 h at 37°C, and then washed by a washing buffer. Color reaction was conducted by successively adding 50 μL coloured solution A and B for 15 min, and then stopped by adding 50 μL terminating solution. Optic density at 450 nm (OD_{450 nm}) was measured using Infinite 200 plate reader (TECAN, Switzerland). The contents of MyHC protein in unknown sample were calculated according to a linear regression equation fitted with the concentrations of quality controls and their corresponding OD_{450 nm}, and expressed as “pg/mg protein”. MyHC protein composition, the proportion of each MyHC protein to total of four MyHC, was calculated as follow:

Total RNA in tissue was isolated using an EZNA HP Total RNA kit (Omega Bio-tek, Norcross, GA, USA). The cDNA was passed through a reverTra Ace qPCR RT kit (Toyobo Co. Ltd., Osaka, Japan), with 3 μL total RNA (about 2 μg), 1 μL primer mix, 1 μL RT enzyme mix, 4 μL 5×RT buffer, 13 μL nuclease-free water. The mixture was incubated at 65°C for 2 min, at 37°C for 15 min, and then at 98°C for 5 min, and last remained at −80°C until being analysed.

Standard mRNA fragments for MyHC I, IIa, IIx and IIb were produced as described by Hu et al. (2008). The primers used were as follows: MyHC I F: 5′-CACTTGCTAAGAGGGACCTCTGAGTTCA-3′, U75316; MyHCIIa F: 5′-AGCCTCTTTCTTCTCCCAGGGACATTC-3′, AB025260; MyHC IIb F: 5′-CATCTGGTAACATAA GAGGTACATCTAG-3′, AB025261; MyHCIIx F: 5′-CTTTCCTCATAAAGCTTCAAGTTCTGCC-3′, AB025262; MyHCs R: ATCCAGGCTGCGTAACGCTCTTTGAGGTT GTA, and were synthesized by Invitrogen Co. Ltd., Shanghai, China. The molecular number of each standard mRNA fragment was calculated according to “copies/μL = 6.02×10²³ (copies/mol)×10⁻⁹×concentration (ng/μL)/RNA length (base numbers)×340 (g/mol/base)”. The standard mRNA fragments were divided into multiples of 10 to 10⁴~10⁸ copies/μL, and then reverse transcribed into cDNA which was used to fit a standard curve of real-time polymerase chain reaction (PCR). The PCR reaction mixture used the SYBR qPCR Mix kit (Toyobo Co., Ltd., Japan) in a volume of 15 μL consisting of 0.3 μL of each primer (10 nM), 7.5 μL SYBR qPCR mix, 0.3 μL ROX reference dye, 2.0 μL cDNA and 4.6 μL (Easy dilution). The reaction was carried out in a StepOne Plus Real-time PCR system (Life Technologies, Carlsbad, CA, USA) for 20 s at 95°C, followed by 40 cycles at 95°C for 5 s and 60°C for 50 s. The molecular numbers of each MyHC mRNA in a muscle sample (copies/mg tissue) was calculated according to the fitted standard curves. MyHC mRNA composition, the proportion of each MyHC mRNA to total of four MyHC, was calculated as MyHC protein composition.

Frozen muscle tissues were weighed, homogenized in normal saline (0.9%) and centrifuged with 3,500×g for 10 min at 4°C. The supernatant was used to measure total protein concentration as described in the above section “Analyzing protein expressions of four MyHC genes in LM”. Another 400-μL supernatant was used to measure succinate dehydrogenase (SDH), malate dehydrogenase (MDH), creatine kinase (CK) and lactate dehydrogenase (LDH) activities using commercial kits (Nanjing Jiangcheng Biochemical Institute, Nanjing, China). The enzyme activities were expressed as “U/mg protein”.

A one-way analysis of variance and Duncan test (p = 0.05) in SPSS16.0 was employed to determine the differences among means from different ages, and all data were expressed as “means±standard deviation (stdv.)”. Association analysis was conducted by Pearson correlation coefficients of bivariate correlations in SPSS16.0.

In Table 1, MyHC I protein content and relative proportion both significantly decreased in the order of “7 days→30 days, 60 days→120 days, 180 days” (p<0.05). MyHC IIa protein content and MyHC IIx protein relative proportions did not significantly change from 30 to 180 days (p>0.05), which were significantly higher than that at 7 days (p<0.05). MyHC IIa protein relative proportion and MyHC IIx protein content both exhibited a tendency of increasing first and decreasing afterwards, and the highest value at 30 days from 7 to 180 days (p<0.05). MyHC IIb protein content and relative proportion both decreased first and increased afterwards, with the lowest value at 30 days during postnatal growth (p<0.05).

In Table 2, MyHC I mRNA abundance and relative proportion both presented an obviously decreasing tendency in the order of “7 days→60 days→120 days→180 days →30 days”, with the significant differences between 7 days and other days, 30 days and other days (p<0.05). MyHC IIa and IIx mRNA both exhibited a tendency of increasing first and decreasing afterwards in both their absolute contents and relative proportions, with the lowest value at 7 days for MyHC IIa mRNA and at 60 days for MyHC IIx mRNA. MyHC IIb mRNA abundance gradually increased with postnatal aging (p<0.05), whereas its relative proportion had a non-significant change between 7 and 30 days, and then significantly increased from 60 days on (p<0.05).

Table 3 showed that, for any MyHC gene, mRNA relative proportion was highly significantly positively correlated with the corresponding protein proportion (p<0.01). But not all of positive correlation was significant (p<0.05), between MyHC mRNA abundance and its protein content.

Table 4 shows the activities of four metabolism enzymes in LM of pigs from different postnatal ages. The activities of MDH and SDH presented an obviously decreasing tendency from 7 to 180 days, with the significant differences between 7 days and other days, 30–60 days and other days (p<0.05). CK activity at 7 days was higher than that of other days (p<0.05), and there was no significantly difference from 7 to 180 days for LDH activity (p>0.05).

In Table 5, the relative proportions of MyHC I mRNA and protein were both positively correlated with the activities of SDH and MDH (p<0.01). The relative proportion of MyHC I mRNA was also positively correlated with CK activity (p<0.01), while the protein relative proportion was negatively correlated with LDH activity (p<0.01).

MyHC are encoded by a multigene family in skeletal muscle of mammalian animals. Eleven MyHC genes have been found in different types of muscle tissue such as skeletal muscle and cardiac muscle. MyHC-neo and MyHC-emb genes are only expressed before birth of animals, while MyHCI, IIa, IIx, and IIb are expressed in skeletal muscles of adult animals (Schiaffino and Reggiani, 2011). Early reports have indicated that MyHC were expressed in a tissue-specific and developmentally regulated manner in muscle (Mahdavi et al., 1987).

The present study found that mRNA transcription and protein expression of four adult MyHC genes all presented some obvious changes with postnatal aging of pigs, especially in the early stage. The result was in agreement with that reported in the literature (Zhao et al., 2004; Yang et al., 2008). The phenomenon could be related with the special developmental stage, dietary changing, and weaning stress. Because in a single myofibre, several types of MyHC isoforms simultaneously exist, and can reverse from one form to another so that a special myofibre may be dominated by a particular MyHC isoform in a specific environment (Reggiani et al., 2000). The phenotypic properties of skeletal muscle fibers can be influenced by various factors such as development, innervation, increased and decreased neuromuscular activity, physical activity (overloading and unloading), hormones and ageing (Sullivan et al., 1995; Schiaffino and Reggiani, 1996; Pette and Staron, 2000). In our result, MyHC IIb and IIx of LM in 30 days and 60 days had the lowest expressions. These could be related to weaning stress of piglets. Weaning stress produced effects on feed intake, growth performance and some endocrine indexes in piglets, such as thyroid hormone and insulin-like growth factor. For skeletal muscle, these growth factors mediate the formation of fast-type myofibers (MusarÒ, et al., 2001; Lynch, et al., 2001). Certainly, effects of weaning on muscle fiber types was very complex and needs to be further researched. Our result only indicated that muscle fibers have the highly adaptability and plasticity for different environmental changes. Moreover, MyHC mRNA changed more sensitively than MyHC protein in muscle with the postnatal aging of pigs in present study. This further confirmed existed previous report that the major regulation of MyHC expression may occur at the mRNA transcriptional level (Cox and Buckingham, 1992).

In human muscle, MyHC protein levels have been confirmed to be positively correlated with mRNA transcript (Short et al., 2005). Gunawan et al. (2007) found that the relative expressive level of MyHC I or IIb mRNA was positively correlated with relative content of the corresponding protein to total content of four MyHC isoforms protein (R² = 0.76 and 0.78, respectively) in various muscles from seven pigs.

The present study respectively determined the mRNA and protein absolute levels of MyHC I, IIa, IIx, and IIb in porcine muscle tissue, through an absolute quantitative real-time PCR and an indirect enzyme-linked immunosorbent assay, and then calculated the relative proportion (%) of each MyHC to total four MyHC. Our results found a positive correlation between mRNA transcriptions and protein expressions in any of the four MyHC genes, including their abundant contents and relative proportions. Especially, the correlation coefficients (r) between the relative proportion of mRNA and that of the corresponding protein ranged from 0.551 to 0.753, and were highly significant. These also confirmed that MyHC expression is transcriptionally regulated (Cox and Buckingham, 1992).

Some researches regarded MyHC expressions as a powerful tool for analyzing fibre type characteristics of muscles (Schiaffino and Reggiani, 1996); Spangenburg and Booth, 2003). Multiple immunochemistry, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and proteomics were used to study MyHC protein expression (Caiozzo et al., 2004; Li et al., 2005), while slot/dot-blot (Diffee et al., 1991), northern blot (Caiozzo et al., 1996), RNase protection assay (Reilly et al., 2000), in situ hybridization (Serrano et al., 2001), and reverse transcriptase reaction coupled to a RT-PCR (Sanchez et al., 2006) were used to determine mRNA transcription. Immunochemistry and SDS-PAGE were regarded as the best semi-quantitative techniques for MyHC protein expression, but they may over-represent predominant proteins and under-represent small amounts of protein (Jankala et al., 1997). With the development of real time RT-PCR technique, quantification of MyHC mRNA could be a more valuable technique to identify changes in MyHC expression (Van Daele, 2010).

According to the metabolic properties of different types (I, IIa, IIx, IIb) of muscle fiber in adult porcine skeletal muscle, type I fibers are classically known to have greater oxidative capacity than type II fibers (Lefaucheur and Gerrard, 2000), which can be reflected in the activity of SDH or MDH. The present study showed that the activities of SDH, CK, and MDH were positively correlated with the compositions of MyHC I mRNA or protein. Thus, MyHC mRNA composition maybe an ideal index reflecting fiber type characteristics in porcine muscle. And we had utilized MyHC mRNA composition as a molecular marker of muscle fiber type composition within skeletal muscle, and revealed the age-related changes and nutritional regulation of myofibre type characteristics of porcine muscle in another paper (Men et al., 2013).