Go to Top Go to Bottom
Gudla, Ishlak, and AbuGhazaleh: The Effect of Forage Level and Oil Supplement on Butyrivibrio fibrisolvens and Anaerovibrio lipolytica in Continuous Culture Fermenters


The objective of this study was to evaluate the effects of forage level and oil supplement on selected strains of rumen bacteria believed to be involved in biohydrogenation (BH). A continuous culture system consisting of four fermenters was used in a 4×4 Latin square design with a factorial arrangement of treatments, with four 10 d consecutive periods. Treatment diets were: i) high forage diet (70:30 forage to concentrate (dry matter basis); HFC), ii) high forage plus oil supplement (HFO), iii) low forage diet (30:70 forage to concentrate; LFC), and iv) low forage plus oil supplement (LFO). The oil supplement was a blend of fish oil and soybean oil added at 1 and 2 g/100 g dry matter, respectively. Treatment diets were fed for 10 days and samples were collected from each fermenter on the last day of each period 3 h post morning feeding. The concentrations of vaccenic acid (t11C18:1; VA) and c9t11 conjugated linoleic acid (CLA) were greater with the high forage diet while the concentrations of t10 C18:1 and t10c12 CLA were greater with the low forage diet and addition of oil supplement increased their concentrations at both forage levels. The DNA abundance of Anaerovibrio lipolytica, and Butyrivibrio fibrisolvens vaccenic acid subgroup (Butyrivibrio VA) were lower with the low forage diets but not affected by oil supplement. The DNA abundance of Butyrivibrio fibrisolvens stearic acid producer subgroup (Butyrivibrio SA) was not affected by forage level or oil supplement. In conclusion, oil supplement had no effects on the tested rumen bacteria and forage level affected Anaerovibrio lipolytica and Butyrivibrio VA.


Trans C18:1 fatty acids (FA) and conjugated linoleic acid (CLA) are produced by the incomplete biohydrogenation (BH) of long chain unsaturated FA in the rumen (Harfoot and Hazlewood, 1997), and are subsequently incorporated into milk and meat of ruminant animals. The different positional and geometric isomers of CLA confer different health effects on mammals (Bhattacharya et al., 2006; Kelly et al., 2007). The c9t11 CLA isomer has been shown to be anticarcinogenic (Amarù and Field, 2009; Huot et al., 2010), while the t10c12 CLA isomer has been shown capable of decreasing body fat and increasing lean body mass (Miranda et al., 2009; Jiang et al., 2010). The t10c12 CLA isomer also decreases fat concentration in dairy cow’s milk in a dose dependent fashion (Peterson et al., 2002).
Formation of trans C18:1 FA and CLA in the rumen are known to be influenced by dietary supplementation with unsaturated plant oils (Varadyova et al., 2007; Doreau et al., 2009; Duckett and Gillis, 2010), fish oil (Jin et al., 2008; Lee et al., 2008) or rumen pH (Sackmann et al., 2003; AbuGhazaleh and Jacobson, 2007; Alzahal et al., 2009). Feeding low forage diets supplemented with plant oils, fish oil or their blend (Loor et al., 2004; AbuGhazaleh and Jacobson, 2007; Belenguer et al., 2010) altered ruminal BH resulting in t10 rather than VA being the predominant trans C18:1 intermediates. Similarly, Fuentes et al. (2009) showed that the flow of VA and c9t11 CLA from fermenters decreased while the flow of t10 C18:1 and t10c12 CLA increased when high concentrate diet replaced high forage diet. Although the effects of lipid supplements and forage level on ruminal trans FA formation are well documented, little information is currently available about the effects of feeding such diets on rumen microbial ecology, particularly, bacterial species believed to be involved in the BH process.
Harfoot and Hazlewood (1997) categorized the bacteria involved in the different steps of the BH pathway into two groups. Group A bacteria hydrogenate linoleic acid (C18:2n6) and linolenic acid (C18:3n3) to VA; in contrast, group B bacteria convert the same FA to 18:0. Using 16S rDNA sequence data, Paillard et al. (2007) constructed a phylogenetic tree that contains two main groups of rumen Butyrivibrio bacteria called vaccenic acid-producing (Butyrivibrio VA) and stearic acid-producing (Butyrivibrio SA). Although both groups formed VA from C18:2n6, only SA bacteria produced C18:0 (Paillard et al., 2007). The main objective of this study was to evaluate the effects of forage level and lipid supplement on Butyrivibrio VA and SA and Anaerovibrio lipolytica using continuous culture fermenters.


Experimental design and treatments

Four single flow continuous fermenters (800 ml) were used in 4×4 Latin square design with 4 periods of 10 d each. Treatment diets were fed (45 g/d dry matter basis) in three equal portions during the day at 0700, 1500 and 2300 h. Treatment diets were: i) high forage diet (70:30 forage to concentrate (dry matter basis); HFC), ii) high forage plus oil supplement (HFO), iii) low forage diet (30:70 forage to concentrate; LFC), and iv) low forage plus oil supplement (LFO). The forage source was alfalfa pellets. The oil supplement was a blend of fish oil (C20:5n3 = 14.6 g/100 g FA; C22:6n3 = 9.8 g/100 g FA) and soybean oil (C18:2n6 = 53.8 g/100 g FA) added at 1 and 2 g/100g DM, respectively. Menhaden fish oil (Omega Protein Inc., Hammond, LA, USA) was used in this study. Corn, soybean meal, and minerals made up the concentrate mix (Table 1).
Whole ruminal contents were collected 4 h after the morning feeding from two ruminally fisulated Holstein cows fed a 50:50 forage:concentrate diet. After collection, ruminal contents were transferred to the laboratory in sealed bags, mixed, and then strained using a double-layered cheese cloth. Approximately 700 ml of the ruminal fluid was added to each of the four fermenters, containing 100 ml of prewarmed buffer. Anaerobic conditions in fermenters were maintained by infusing CO2 at 45 ml/min. Cultures were stirred continuously at 45 rpm and fermenter pH was measured daily before feeding using a portable pH meter. Fermenter temperature was maintained at 39°C using a circulating water bath. Buffer was delivered continuously at a flow rate of 1.25 ml/min (11%/h liquid dilution rate), using a precision pump. Flow rate of each fermenter was recorded every day at 07:00.

Sample collection and analyses

On day 10 of each period, two 10-ml samples were collected from each fermenter, using a wide-bore pipette, at 3 h post morning feeding for FA analysis (AbuGhazaleh and Jacobson, 2007) and bacterial analysis (AbuGhazaleh et al., 2011; Potu et al., 2011). Briefly, bacterial samples collected from fermenters were frozen immediately in liquid nitrogen and stored at −80°C until bacterial analysis. Samples were thawed, thoroughly mixed and 1 ml subsample was then used for DNA extraction using the MO BIO Ultraclean Microbial DNA isolation kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA). Purified cultures of Butyrivibrio SA (DSMZ 10302), Butyrivibrio VA (DSMZ 10316), and Anaerovibrio lipolytica (DSMZ 3074) were obtained from DSMZ (German resource center for biological material, Braunschweig, Germany) and grown in our laboratory in sealed Hungate tubes as specified by DSMZ. The three bacteria were used to generate standard curves for the relative quantitation analyses (AbuGhazaleh et al., 2011; Potu et al., 2011). The slopes and coefficient of determination (R2) for the standard curves were −3.456 and 0.995 for Butyrivibrio SA, −3.654 and 0.995 for Butyrivibrio VA, and −3.635 and 0.989 for Anaerovibrio lipolytica, repectively. The primer pairs for Anaerovibrio lipolytica was described by Tajima et al. (2001). The primer pairs for Butyrivibrio SA and Butyrivibrio VA were described by Fuentes et al. (2009). The specificity of primers was confirmed using the BLAST program in the GeneBank Database. The PCR products for all tested bacteria were sent also to laboratory (GENEWIZ, South Plainfield, NJ, USA) for sequence validation (> 98%).
Individual species-specific real time quantitative PCR (qPCR) was performed using Bio-Rad iCycler MyiQ single color real-time PCR detection system (Bio-Rad laboratories, Inc, Hercules, CA, USA), using fluorescence detection of SYBR green mix (Bio-Rad laboratories, Inc, Hercules, CA, USA) as described by AbuGhazaleh et al. (2011) and Potu et al. (2011). Briefly 12.5 μl SYBR green mix, 2 μl of each primer, sample DNA (starting concentration; Table 2), and RNAse free water were added to make a total volume of 25 μl. Amplifications for Anaerovibrio lipolytica and Butyrivibrio SA and Butyrivibrio VA were described by Potu et al. (2011) and Fuentes et al. (2009), respectively. Standard curves, DNA sample quantification and melting curve analyses were obtained using iQ5 Optical System Software (version 2.1, Bio-Rad laboratories, Inc, Hercules, CA, USA). Melting curve analysis was performed after each amplification step to determine the specificity of PCR product. Samples were amplified in triplicate along with dilution standards of known bacterial DNA concentrations. Samples and standards were assayed on the same plate to allow for the relative quantification of bacterial DNA present in sample.

Statistical analysis

Data were analyzed as a 4×4 Latin square design in a 2× 2 factorial design using the PROC MIXED of SAS (SAS Institute, Inc., Cary, NC). The statistical model included: forage effect, oil effect, and their interactions. Fixed effects were treatment diets and period. Random effect was fermenter. Results were expressed as least square means with standard error of the means. The significance threshold was set at p<0.05. The statistical model was:
where Yijk = the observation; μ = overall mean; Fi = forage effect (forage level; HF and LF); Oj = oil effect; Pij = forage and oil interaction and eij = residual error.


The fermenters pH for the high and low forage diets averaged 6.58 and 5.53, respectively and was not affected by oil supplement. The effects of forage level and oil supplement on selected BH intermediates are presented in Table 3. The greater concentration of trans C18:1 along with the lower concentration of C18:0 with the LFC relative to the HFC suggest an incomplete BH of unsaturated FA with the LFC. Low ruminal pH, caused by a high-concentrate diet, increased the accumulation of trans C18:1 in other studies (Piperova et al., 2002; Loor et al., 2004; AbuGhazaleh and Jacobson, 2007). Although the cause of the accumulation of trans C18:1 under low rumen pH conditions is still unknown, alteration of the rumen ecosystem and/or inhibition of the reductase activity of ruminal microorganisms responsible for the reduction of trans C18:1 to C18:0 have been suggested (Loor et al., 2004; AbuGhazaleh and Jacobson, 2007). Despite the greater concentration of trans C18:1 with the LFC diet, the greater concentrations of BH products (the sum of trans C18:1 and C18:0) seen with the HFC (12.22 mg/g of DM) compared with the LFC (6.61 mg/g of DM) suggest greater microbial BH activities with the high forage diets. The increase in the concentration of trans C18:1 with oil supplement was expected as inputs of dietary C18 unsaturated FA, the precursors for trans C18:1, were increased with the oil supplement. Other studies also reported similar increases in trans C18:1 concentration in rumen (Varadyova et al., 2007; Belenguer et al., 2010) and duodenum (Kucuk et al., 2008) when oils were included in the diets of ruminant animals. The greater increase in trans C18:1 concentration with oils addition to the high forage diet further support the findings that greater BH activities occurred in fermenters fed the high forage diets (discussed below).
The concentration of VA was greater (p<0.05) with the high forage diets while the concentration of t10 C18:1 was greater (p<0.05) with the low forage diets and both increased (p<0.05) further with oil supplementation (Table 3). Similarly, the concentration of c9t11 CLA was greater (p<0.05) with the high forage diets while the concentration of t10c12 CLA was greater (p<0.05) with the low forage diets and both increased (p<0.05) further with oil supplementation. The lower concentrations of VA and c9t11 CLA with the low forage diet are consistent with previous studies that showed a shift toward t10 C18:1 and t10c12 CLA formation with decreasing dietary forage level (Piperova et al., 2002; Sackmann et al., 2003; AbuGhazaleh and Jacobson, 2007) or low ruminal pH (Choi et al., 2005; Fuentes et al., 2009). At a constant dietary oil level, AbuGhazaleh and Jacobson (2007) showed that decreasing dietary forage levels resulted in t10 C18:1 and t10c12 CLA replacing VA and c9t11 CLA, respectively as predominate trans C18:1 and CLA isomers in fermenters. Additionally, t10 C18:1 replaced VA as the predominant trans C18:1 isomer in the rumen when high concentrate-low fiber diets were fed to cows (Loor et al., 2004) and steers (Sackmann et al., 2003). Relative to t10 C18:1, the increase in VA concentrations with oil supplements were more markedly with the high forage diet (forage×oil interaction, p<0.01) possibly indicating more active BH.
The effects of treatment diets on the DNA abundance of the selected ruminal bacteria are presented in Table 4. Dietary oil supplement had no effects (p>0.05) on the DNA abundance of Anaerovibrio lipolytica and Butyrivibrio VA-producing bacteria at both forage levels. Potu et al. (2011) reported no effects for fish oil or soybean oil supplementation at 3% of diet DM on Anaerovibrio lipolytica. Feeding fish oil, sunflower oil or their combination to dairy sheep had no effect on the abundance of Butyrivibrio VA-producing bacteria (Belenguer et al., 2010). Maia et al. (2007) also reported no change in the growth of Anaerovibrio lipolytica upon incubating with PUFA at 50 μg/ml; demonstrating the low sensitivity of Anaerovibrio lipolytica to oil supplements. The DNA abundances for Anaerovibrio lipolytica and Butyrivibrio VA-producing bacteria were significantly lower with the low forage diets suggesting that these bacteria are sensitive to low pH conditions. This is in agreement with Fuentes et al. (2009) who also reported similar decreases in the DNA abundance for Anaerovibrio lipolytica and Butyrivibrio VA-producing bacteria when fermenters pH was reduced from 6.4 to 5.6. Hobson (1965) and Henderson et al. (1969) also reported lower growth and lipase activity for Anaerovibrio lipolytica under low pH conditions. The decrease in Anaerovibrio lipolytica and Butyrivibrio VA-producing bacteria with low forage diets may, in part, explain the greater concentrations of C18:2n6 and C18:1n9 and the lower concentrations of BH end-products (trans C18:1 and C18:0) with the low forage diets relative to the high forage diets. Switching lactating dairy cows from a high to a low forage diet, which promotes low rumen pH, resulted in lower levels of lipolytic activity and BH of unsaturated FA in ruminal fluid as measured by in vitro experiment (Van Nevel and Demeyer, 1996; AbuGhazaleh and Jacobson, 2007).
Interestingly, dietary oil supplement and forage level had no effects on the DNA abundance of Butyrivibrio SA-producing bacteria in spite of the decrease in C18:0 concentrations with oil supplementation and low forage diets (Table 3). Butyrivibrio SA-producing bacteria was identified to be the ruminal species responsible for the conversion of trans C18:1 into C18:0 (Paillard et al., 2007). The lack of significant effect of fish oil and low pH on Butyrivibrio SA-producing bacteria has been also reported by Belenguer et al. (2010) and Fuentes et al. (2009), respectively. Kim et al. (2008) and Huws et al. (2010) also reported that DNA abundance from the Butyrivibrio SA- producing group did not correlate with the C18:0 concentrations suggesting that Butyrivibrio SA-producing group may not indeed by the main C18:0 producer in the rumen. These results, therefore, would suggest that other, yet-uncultivated microbial species might be involved in C18:0 production and might fulfill a more important role in the final step of the BH process. Additionally, it’s still also possible that oil supplement and low forage diets decreased the capacity of these bacteria to hydrogenate trans C18:1 rather than the bacteria as such. A recent study by Maia et al. (2010) reported that the inhibitory-growth effects of unsaturated FA on bacteria may be mediated via metabolic means rather than disruption of cell membrane.


The concentrations of VA and c9t11 CLA were greater with the high forage diets while the concentrations of t10 C18:1 and t10c12 CLA were greater with the low forage diets and concentrations of these trans FA were further increased with oil supplementation. The lower concentrations of BH products (CLA, trans C18:1 and C18:0) seen with the low forage diets was in parallel with the lower DNA abundance for Butyrivibrio VA suggesting a role of these bacteria in trans FA formation particularly under high ruminal pH conditions. The nonresponsive effects of Butyrivibrio SA to oil supplementation and forage levels may indicate that these bacteria play a minor role in the production of C18:0 from trans C18:1.

Table 1
Ingredients of treatment diets
Ingredient (g/kg DM) Treatment

Alfalfa hay 700.00 700.00 300.00 300.00
Soybean meal 45.00 45.00 113.00 113.00
Ground corn 250.00 220.00 582.00 552.00
Soybean oil 0.00 20.00 0.00 20.00
Fish oil 0.00 10.00 0.00 10.00
Minerals mixe 5.00 5.00 5.00 5.00

a HFC = High forage control diet; alfalfa pellets at 700 g/kg (diet DM) and no oil supplementation.

b HFO = High forage oil diet; control diet with 20 g/kg (diet DM) soybean oil and 10 g/kg (diet DM) fish oil.

c LFC = Low forage control diet; alfalfa pellets at 300 g/kg (diet DM) and no oil supplementation.

d LFO = Low forage oil diet; control diet with 20 g/kg (diet DM) soybean oil and 10 g/kg (diet DM) fish oil.

e Contained (g/kg): NaCl (955 to 9.8), Zn (10.0), Mn (7.5), Fe (6.0), Mg (0.5), Cu (0.32), I (0.28), and Co (0.11).

Table 2
PCR primers and starting DNA concentration for detection of selected ruminal bacteria
Target bacterium Primer sequences (5′-3′) Starting DNA concentration (ng)/25 μl Annealing temp (°C) Product size (bp)
18 60 126
18 60 124
Anaerovibrio lipolytica F: TGGGTGTTAGAAATGGATTCC
60 57 597
Table 3
The effect of forage level and oil supplements on fermenter fatty acid (mg/g DM)
Fatty acid Treatment MSE p value

HFCa HFOb LFCc LFOd Forage Oil Forage×oil
C18:0 9.47 3.81 0.98 3.03 0.612 0.01 0.02 0.01
C18:1 total trans 2.75 17.71 5.63 12.33 0.887 0.20 0.07 0.57
t10 C18:1 0.24 0.79 5.08 9.09 0.462 0.01 0.01 0.01
t11 C18:1 (VA)e 2.05 15.78 0.41 2.02 0.886 0.01 0.01 0.01
C18:1n9 1.99 5.14 7.15 7.08 1.012 0.01 0.18 0.17
C18:2n6 2.43 4.56 7.07 10.67 0.559 0.01 0.01 0.24
C18:3n3 0.84 1.12 0.81 1.26 0.101 0.61 0.01 0.44
c9t11 CLAf 0.18 0.58 ndg 0.06 0.054 0.01 0.01 0.01
t10c12 CLA nd 0.02 0.09 0.48 0.061 0.01 0.01 0.02

a HFC = High forage control diet; alfalfa pellets at 700 g/kg (diet DM) and no oil supplementation.

b HFO = High forage oil diet; control diet with 20 g/kg (diet DM) soybean oil and 10 g/kg (diet DM) fish oil.

c LFC = Low forage control diet; alfalfa pellets at 300 g/kg (diet DM) and no oil supplementation.

d LFO = Low forage oil diet; control diet with 20 g/kg (diet DM) soybean oil and 10 g/kg (diet DM) fish oil.

e VA = Vaccenic acid.

f CLA = Conjugated linoleic acid.

g nd = Not detected.

Table 4
The effect of forage level and oil supplements on the DNA abundance (pg) of selected rumen bacteria at a given starting concentration
Bacteria Treatment MSE p value

HFCa HFOb LFCc LFOd Forage Oil Forage×oil
Butyrivibrio SA, 18ng* 14.93 13.61 12.34 15.82 1.105 0.87 0.36 0.07
Butyrivibrio VA, 18ng* 0.33 0.29 0.01 0.01 0.044 0.01 0.77 0.72
Anaerovibrio lipolytica, 60 ng* 1.67 2.6 0.05 0.09 0.449 0.01 0.32 0.36

a HFC = High forage control diet; alfalfa pellets at 700 g/kg (diet DM) and no oil supplementation.

b HFO = High forage oil diet; control diet with 20 g/kg (diet DM) soybean oil and 10 g/kg (diet DM) fish oil.

c LFC = Low forage control diet; alfalfa pellets at 300 g/kg (diet DM) and no oil supplementation.

d LFO = Low forage oil diet; control diet with 20 g/kg (diet DM) soybean oil and 10 g/kg (diet DM) fish oil.

* Starting concentration.


AbuGhazaleh AA, Jacobson BN. 2007. Production of trans-C18:1 and conjugated linoleic acid production by ruminal microbes in continuous culture fermenters fed diets containing fish oil and sun flower oil with decreasing levels of forage. Animal 1:660–665.
crossref pmid
AbuGhazaleh AA, Abo-El-Nor S, Ibrahim SA. 2011. The effect of replacing corn with glycerol on ruminal bacteria in continuous culture fermenters. J Anim Physiol Anim Nutr 95:313–319.
Alzahal O, Or-Rashid MM, Greenwood SL, Douglas MS, McBride BW. 2009. The effect of dietary fiber level on milk fat concentration and fatty acid profile of cows fed diets containing low levels of polyunsaturated fatty acids. J Dairy Sci 92:1108–1116.
crossref pmid
Amarù DL, Field CJ. 2009. Conjugated linoleic acid decreases MCF-7 human breast cancer cell growth and insulin-like growth factor-1 receptorl. Lipids 44:449–458.
crossref pmid
Belenguer A, Toral PG, Frutos P, Hervas G. 2010. Changes in the rumen bacterial community in response to sunflower oil and fish oil supplements in the diet of dairy sheep. J Dairy Sci 93:3275–3286.
crossref pmid
Bhattacharya A, Causey J, Fernandes G, Banu J, Rahman M. 2006. Biological effects of conjugated linoleic acids in health and disease. J Nutr Biochem 17:789–810.
crossref pmid
Choi NJ, Imm JY, Oh S, Kim BC, Hwang HJ, Kim YJ. 2005. Effect of pH and oxygen on conjugated linoleic acid (CLA) production by mixed rumen bacteria from cows fed high concentrate and high forage diets. Anim Feed Sci Technol 123–124:643–653.
Doreau M, Chesneau G, Glasser F, Laverroux S, Normand J. 2009. Effect of linseed fed as rolled seeds, extruded seeds or oil on fatty acid rumen metabolism and intestinal digestibility in cows. Lipids 44:53–62.
crossref pmid
Duckett SK, Gillis MH. 2010. Effects of oil source and fish oil addition on ruminal biohydrogenation of fatty acids and conjugated linoleic acid formation in beef steers fed finishing diets. J Anim Sci 88:2684–2691.
crossref pmid
Fuentes MC, Calsamiglia S, Cardozo PW, Vlaeminc B. 2009. Effect of pH and level of concentrate in the diet on the production of biohydrogenation intermediates in a dual-flow continuous culture. J Dairy Sci 92:4456–4466.
crossref pmid
Harfoot CG, Hazlewood G. 1997. Lipid metabolism in the rumen. The rumen microbial ecosystem. Hobson PN, Stewart CS, editorsBlackie and Prof; London, UK: p. 382–426.
Henderson C, Hobson PN, Summers R. 1969. The production of amylase, protease, and lipolytic enzymes by two species of anaerobic rumen bacteria. In : Proc. 4th Int. Symp. Prague, Czechoslovakia: Continuous Culture Microorganisms; p. 189

Hobson P. 1965Continuous culture of some anaerobic and facultatively anaerobic rumen bacteria. J Gen Microbiol 38:167–180.
crossref pmid
Huot PSP, Ma DWL, Sarkar B. 2010. Conjugated linoleic acid alters caveolae phospholipid fatty acid composition and decreases caveolin-1 expression in MCF-7 breast cancer cells. Nutr Res 30:179–185.
crossref pmid
Huws SA, Lee MRF, Muetzel SM, Scott MB, Wallace RJ. 2010. Forage type and fish oil causes shifts in rumen bacterial diversity. FEMS Microbiol Ecol 73:396–407.
crossref pmid
Jiang ZY, Yang L, Jiang SQ, Lin YC, Zhong WJ, Zheng CT. 2010. Conjugated linoleic acid differentially regulates fat deposition in backfat and longissimus muscle of finishing pigs. J Anim Sci 88:694–1705.
Jin GL, Kim YJ, Song MK, Choi SH, Lee HG. 2008. Effects of monensin and fish oil on conjugated linoleic acid production by rumen microbes in Holstein cows fed diets supplemented with soybean oil and sodium bicarbonate. Asian-Aust J Anim Sci 21:1728–1735.
Kelley NS, Erickson KL, Hubbard NE. 2007. Conjugated linoleic acid isomers and cancer. J Nutr 137:2599–2607.
crossref pmid
Kim EJ, Huws SA, Lee MRF, Wood JD, Muetzel SM, Wallace R. 2008. Fish oil increases the duodenal flow of long chain polyunsaturated fatty acids and trans-11 18:1 and decreases 18:0 in steers via changes in the rumen bacterial community. J Nutr 138:889–896.
crossref pmid
Kucuk O, Hess BW, Rule DC. 2008. Fatty acid compositions of mixed ruminal microbes isolated from sheep supplemented with soybean oil. Res Vet Sci 84:215–224.
crossref pmid
Lee MRF, Shingfield KJ, Tweed JKS, Toivonen V, Huws SA, Scollan ND. 2008. Effect of fish oil on ruminal biohydrogenation of C18 unsaturated fatty acids in steers fed grass or red clover silages. Animal 2:1859–1869.
crossref pmid
Loor JJ, Ueda K, Ferlay A, Chilliard Y, Doreau M. 2004. Biohydrogenation, duodenal flow, and intestinal digestibility of trans fatty acids and conjugated linoleic acids in response to dietary forage:concentrate ratio and linseed oil in dairy cows. J Dairy Sci 87:2472–2485.
crossref pmid
Maia MR, Chaudhary LC, Figueres L, Wallace RJ. 2007. Metabolism of polyunsaturated fatty acids and their toxicity to the microflora of the rumen. Antonie Van Leeuwenhoek 91:303–314.
crossref pmid
Maia MR, Chaudhary LC, Bestwick CS. 2010. Toxicity of unsaturated fatty acids to biohydrogenating ruminal bacterium, Butyrivibrio fibrisolvens. BMC Microbiol 10:52
crossref pmid pmc
Miranda J, Churruca I, Fernández-Quintela A, Rodríguez VM, Macarulla MT, Simón E, Portillo MP. 2009. Weak effect of trans-10, cis-12-conjugated linoleic acid on body fat accumulation in adult hamsters. Br J Nutr 102:1583–1589.
crossref pmid
Paillard D, McKain N, Chaudhary LC, Walker ND, Pizette F, Koppova I, McEwan NR, Kopecny J, Vercoe PE. 2007. Relation between phylogenetic position, lipid metabolism and butyrate production by different Butyrivibrio-like bacteria from the rumen. Antonie Van Leeuwenhoek 91:417–422.
crossref pmid
Peterson DG, Baumgard LH, Bauman DE. 2002. Short communication: milk fat response to low doses of trans-10, cis-12 conjugated linoleic acid (CLA). J Dairy Sci 85:1764–1766.
crossref pmid
Piperova LS, Sampugna J, Teter BB, Kalscheur KF, Yurawecz MP, Ku Y, Morehouse KM, Erdman RA. 2002. Duodenal and milk trans octadecenoic acid and conjugated linoleic acid (CLA) isomers indicate that postabsorptive synthesis is the predominant source of cis-9-containing CLA in lactating dairy cows. J Nutr 132:1235–1241.
crossref pmid
Potu RB, AbuGhazaleh AA, Hastings D, Jones K, Ibrahim SA. 2011. The effect of lipid supplements on ruminal bacteria in continuous culture fermenters varies with the fatty acid composition. J Microbiol 49:216–223.
crossref pmid
Sackmann JR, Duckett SK, Gillis MH, Realimi CE, Parks AH, Eggelston RB. 2003. Effects of forage and sunflower oil levels on ruminal biohydrogenation of fatty acids and conjugated linoleic acid formation in beef steers and finishing diets. J Anim Sci 81:3174–3181.
crossref pmid
Tajima K, Aminov RI, Nagamine T, Matsui H, Nakamura M, Benno Y. 2001. Diet-dependent shifts in the bacterial population of the rumen revealed with real-time PCR. Appl Environ Microbiol 67:2766–2774.
crossref pmid pmc
Van Nevel CJ, Demeyer DI. 1996. Influence of pH on lipolysis and biohydrogenation of soybean oil by rumen contents in vitro. Reprod Nutr Dev 36:53–63.
crossref pmid
Varadyova Z, Kišidayova S, Siroka P, Jalč D. 2007. Fatty acid profiles of rumen fluid from sheep fed diets supplemented with various oils and effect on the rumen ciliate population. Czech J Anim Sci 52:399–406.

Editorial Office
Asian-Australasian Association of Animal Production Societies(AAAP)
Room 708 Sammo Sporex, 23, Sillim-ro 59-gil, Gwanak-gu, Seoul 08776, Korea   
TEL : +82-2-888-6558    FAX : +82-2-888-6559   
E-mail : animbiosci@gmail.com               

Copyright © 2021 by Animal Bioscience. All rights reserved.

Close layer
prev next