Go to Top Go to Bottom
Anim Biosci > Volume 29(8); 2016 > Article
Cho, Jeong, Lee, Park, Kim, Park, Shin, Jeon, Shim, Choi, Seo, Cho, Kim, Ko, Seo, Lee, Chae, and Lee: Regional Differences of Proteins Expressing in Adipose Depots Isolated from Cows, Steers and Bulls as Identified by a Proteomic Approach

Abstract

Adipose tissue in the loin muscle area of beef cattle as a marbling factor is directly associated with beef quality. To elucidate whether properties of proteins involved in depot specific adipose tissue were sex-dependent, we analyzed protein expression of intramuscular adipose tissue (IMAT) and omental adipose tissue (OMAT) from Hanwoo cows, steers, and bulls of Korean native beef cattle by liquid chromatography-tandem mass spectrometry (LC-MS/MS)–based proteomic analysis, quantitative polymerase chain reaction (PCR) and western blot analysis. Two different adipose depots (i.e. intramuscular and omental) were collected from cows (n = 7), steers (n = 7), or bulls (n = 7). LC-MS/MS revealed a total of 55 and 35 proteins in IMAT and OMAT, respectively. Of the 55 proteins identified, 44, 40, and 42 proteins were confirmed to be differentially expressed in IMAT of cows, steers, and bulls, respectively. In OMAT of cows, steers, and bulls, 33, 33, and 22 were confirmed to be differentially expressed, respectively. Tropomyosin (TPM) 1, TPM 2, and TPM3 were subjected to verification by quantitative PCR and western blot analysis in IMAT and OMAT of Hanwoo cows, steers, and bulls as key factors closely associated with muscle development. Both mRNA levels and protein levels of TPM1, TPM2, and TPM3 in IMAT were lower in bulls compared to in cows or steers suggesting that they were positively correlated with marbling score and quality grade. Our results may aid the regulation of marbling development and improvement of meat quality grades in beef cattle.

INTRODUCTION

One important goal of farm animal industry is to produce high quality beef. Beef quality is normally defined by the compositional quality (lean to fat ratio) and the palatability factors such as visual appearance, smell, firmness, juiciness, tenderness, and flavor. Many studies have indicated that meat tenderness is not only affected by protein composition of muscle fibers, but also by handling and slaughtering conditions, genetic traits, and growth progress. In addition, there is some connection between tenderness and flavor through marbling of meat (Hughes et al., 2014).
Generally, marbling means the amount of intramuscular fat (Purslow, 2005; Nishimura, 2010), one of the main factors used to determine beef quality and grade in Korea. Marbling is a very important and valuable trait in the beef cattle industry (Lee et al., 2007). Previous studies have found a relationship between marbling score and percent intramuscular fat (Jeong et al., 2012; Walter et al., 2014). Therefore, the content and distribution of body fats are of special interest for production efficiency and meat quality in farm animal industry (Gondret et al., 2008).
Contents and deposition of intramuscular fat can be influenced by several factors, including sex, age, breed, genotype, nutrition, and environmental factors (Maltin et al., 2003; Hausman et al., 2006). Generally, steers have more intramuscular fat, higher marbling score (Destefanis et al., 2003; Schreurs et al., 2008), and more tender meat (Peachey et al., 2002; Purchas et al., 2002) than bulls. Fat storage in cattle muscle is correlated with intramuscular fat percentage (Guo et al., 2014) because the hormonal status of beef cattle from different sex is related to meat quality characteristics, such as tenderness, fat, and protein distribution (Fritsche and Steinhart, 1998). Particularly, castration dramatically increases intramuscular fat deposition, resulting in improved beef quality in Korean cattle (Park et al., 2002).
The effects of sex steroid hormonal status, including testosterone, androgen, and estrogen, on muscle tissue and myogenic satellite cells (MSCs) have been well studied (Inoue et al., 1994; Arnold et al., 1996; Kahlert et al., 1997; Lee, 2002; Sinha-Hikim et al., 2003; Enns et al., 2008).
MSCs are adult stem cells that activate and differentiate into myotubes. Our previous studies investigated the importance of hormonal components in MSC growth and lipid droplets accumulation (Lee et al., 2011). The effect of natural hormones in adult bovine serum (cow, steer, and bull serum) in MSC proliferation was observed. We found that MSC proliferation was the highest in media supplemented with bull serum followed by cow and steer serum. Lipid droplets accumulation was increased in myotubes when MSCs were treated with 17β-estradiol (E2) followed by E2+testosterone or testosterone treatment alone. This may be due to various hormonal components present in the different sera. Our data have demonstrated that sex hormones are key factors affecting the proliferation of MSCs and lipid accumulation in myotubes (Lee et al., 2011).
However, factors important for the improvement of beef quality grade with sex and hormonal differences are not clearly understood in vivo. Therefore, identification of differentially expressed proteins in adipose depots of different sexes might be helpful in defining the functions of intramuscular fat, therefore providing strategies to control meat lipid content independently of body fat depots. The objective of this study was to determine whether proteins involved in depot specific adipose tissue properties were sex dependent. We analyzed the proteome expression of intramuscular adipose tissue (IMAT) and omental adipose tissue (OMAT) in native Hanwoo Korean beef cattle (cows, steers, and bulls) by liquid chromatography-tandem mass spectrometry (LC-MS/MS)–based proteomic analysis, quantitative polymerase chain reaction (PCR), and western blot analysis.

MATERIALS AND METHODS

Animals and sample collection

All experimental procedures involving animals were approved by the National Institute of Animal Science Institutional Animal Use and Care Committee (NIASIAUCC) and conducted in accordance with the Animal Experimental Guidelines provided by NIASIAUCC in Republic of Korea. We used adipose tissue samples of cows (n = 7), steers (n = 7), and bulls (n = 7). Tissue samples were collected in three animals groups from two different adipose depots (i.e. intramuscular and omental). Slaughter age was approximately 31 months for all cattles. Carcass weight was 406.1±13.4, 452.6±12.3, and 490.9±13.6 kg for cows, steers, and bulls, respectively.

Gel electrophoresis and silver staining

Adipose tissues were collected from cows, steers, and bulls. Total protein isolation was performed using PRO-PREP protein extraction solution (iNtRON Biotechnology, Seoul, Korea) according to the manufacturer’s instructions. Proteins eluted were measured using Pierce BCA Protein Assay Kit (Thermo scientific, Rockford, IL, USA). Equal amounts of protein samples were precipitated with cold acetone. Protein pellets were dissolved in 1× sodium dodecyl sulphate (SDS) sample buffer and separated by 12% sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS-PAGE). Following SDS-PAGE, protein spots were visualized using protocols described in the PlusOne Silver staining kit (GE Healthcare Bio-Sciences, Uppsala, Sweden). Complete protocol was followed for analytical gels. For preparative gels, the protocol was modified. Glutaraldehyde was omitted from the sensitization step. Formaldehyde was omitted from the silver reaction step (Yan et al., 2000). Silver-stained gels were scanned (UMAX PowerLook 2100KL Imaging system, UMAX, Taiwan) and protein profiles were compared.

Liquid chromatography-tandem mass spectrometry (LC-MS/MS)

The resulting tryptic peptides were separated and analyzed using reversed-phase capillary high-performance liquid chromatography directly coupled to a Thermo LTQ Orbitrap mass spectrometer following the procedure described by Zuo et al. (2001) with slight modifications. Briefly, both a 0.075×20 mm trapping column and a 0.075× 120 mm resolving column were packed with C18AQ 218MS low formic acid C18 beads (5 μm in size, 200Å pore size; C18AQ, Michrom BioResources, Auburn, CA, USA) and placed in-line. Peptides were bound to the trapping column for 10 min with 2% (vol/vol) aqueous cetonitrile containing 0.1% (vol/vol) formic acid. The bound peptides were eluted with a gradient of 2% to 90% (vol/vol) acetonitrile containing 0.1% (vol/vol) formic acid at a flow rate of 0.2 μL/min. For tandem mass spectrometry, full mass scan range mode was set at m/z = 50 to 2,000 Da. After determining the charge states of the ion zoom scans, product ion spectra were acquired in MS/MS mode with relative collision energy of 55%. Individual spectrum from MS/MS was processed using Protein discoverer 2.1 software (Thermo scientific, USA). The generated peak list files were used to query either the MSDB or the NCBI database using MASCOT program (http://www.matrixscience.com). We took into account modifications of methionine and cysteine, peptide mass tolerance at 2 Da, MS/MS ion mass tolerance at 0.8 Da, allowance of missed cleavage at 2, and charge states (namely, +1, +2, and +3). Only significant hits defined by MASCOT probability analysis were initially considered.

RNA extraction and real-time PCR analysis

Adipose tissues were collected from cows, steers, and bulls. Total RNA isolation was performed using TRIzol reagent (Invitrogen, Grand Island, NY, USA) according to the manufacturer’s instructions. Briefly, total RNA levels were quantified at absorbance of 260 nm. RNA integrity was evaluated by 1.2% (w/v) agarose gel. Total RNA (2 μg amounts) was reverse-transcribed into cDNA using QuantiTect Reverse Transcription Kit (Qiagen, Chatsworth, CA, USA) according to the manufacturer’s instructions. Real-time PCR was performed with SYBR green Premix Ex Taq II (Takara, Dalian, China) using Applied Biosystems StepOne Plus Real-time PCR System (Applied Biosystems, Carlsbad, CA, USA). The expression of β-actin was used as the endogenous control. Relative quantification analysis was performed using the comparative Ct (2−ΔΔCt) method (Wilting et al., 2010). Primers used in the study are listed in Table 1.

Statistical analysis

Data are reported as the mean±standard deviation of at least three independent experiments. Statistical significance was evaluated using Student’s t-test. Compared to the vehicle control, p<0.05 were considered significant.

RESULTS AND DISCUSSION

Carcass characteristics

We used cows (636 kg live weight), steers (762 kg live weight), and bulls (832 kg live weight) at normal slaughter age (31 months) in Korea. Generally, Korean beefs are slaughtered routinely at 29 to 32 month of age to increase marbling and quality grade (Choy et al., 2012). Carcass characteristics of a subset data of the cows, steers, and bulls used for proteomic analysis are summarized in Table 2. Bulls had significantly (p<0.05) heavier carcass weight with lower trend backfat thickness. Bulls also had significantly (p<0.05) lower marbling scores, quality grade, and better yield grade. Our result was mostly in consistent with the effect of castration on meat quality in Korean cattle reported in a previous study (Jeong et al., 2013).

Protein profiles in IMAT and OMAT from Hanwoo cows, steers and bulls

To obtain a comprehensive overview of protein components in IMAT and OMAT from individual seven groups (cows, steers, and bulls), protein profiles of whole lysate of IMAT and OMAT were separated by SDS-PAGE and assessed by silver-stained image analysis. The number, marbling score, and quality grade of individuals were showed in Figure 1A. The patterns of total proteins in IMAT and OMAT were similar to each other. However, IMAT components were significantly different from OMAT components (Figure 1B).

Protein identification and gene ontological classification by LC-MS/MS-based proteomic analysis

LC-MS/MS-based proteomic analysis was performed to identify proteins involved in depot specific adipose tissue (i.e. intramuscular and omental) properties associated with sex (cows, steers, and bulls). Of the 55 proteins identified, 44, 40, and 42 proteins were confirmed to be differentially expressed in IMAT of cows, steers, and bulls, respectively. In OMAT of cows, steers, and bulls, 33, 33, and 22 were confirmed to be differentially expressed, respectively (Table 3). All identified proteins were clustered into eight categories based on biological process (BP) using information obtained from the DAVID gene ontology (GO) database (http://david.abcc.ncifcrf.gov) and UniProt (http://www.uniprot.org). Depending on the BP in which the proteins were involved, they were categorized into the following groups (Figure 2A): carbohydrate metabolism (35.7%), glycolysis (19.6%), muscle contraction (10.7%), electron transport (10.7%), protein folding (7.1%), muscle development (5.4%), tricarboxylic acid (TCA) pathway (5.4%), and carbon metabolism (5.4%).
A total of 16 up- or down-regulated proteins between IMAT and OMAT of cows, steers, and bulls were selected. GO analysis was performed using DAVID Bioinformatics Resources 6.7 categories both Reactome-Pathway and Panther-BP. Depending on the Reactome-Pathway in which the protein was involved, the 16 proteins were categorized into the following five groups (Figure 2B): metabolism of carbohydrates (37%), integration of energy metabolism (22.2%), diabetes pathways (22.2%), muscle development (11.1%), and TCA cycle (7.4%). Depending on the Panther-BP in which the protein was involved, they were categorized into the following six groups (Figure 2C): carbohydrate metabolism (33.3%), glycolysis (23.3%), cell structure (13.3%), muscle development (10%), muscle contraction (10%), and cell motility (10%) (Table 4). The expression changes of the up- and down-regulated proteins in IMAT and OMAT of cows, steers, and bulls depending on the Reactome-Pathway were summarized in Table 4. The mRNA expression patterns of the 16 selected proteins were further analyzed by real-time PCR.

Quantitative real-time PCR confirmation for selected genes

To study the patterns of gene expression in IMAT and OMAT associated with sex, we used cows, steers, and bulls. The mRNA expression levels of the selected genes were subjected to quantitative real-time PCR with specific primers (Table 1). Previous studies have reported that fructose-bisphosphate aldolase A (ALDOA) mRNA increases during in vitro myogenesis (Colbert and Ciejek-Baez, 1988) are responsible for significant activation during the differentiation of primary myoblasts, therefore playing important roles in muscle gene transcription (Walsh et al., 1980; Hidaka et al., 1993; Ren et al., 2011). Our data showed that ALDOA had significantly higher expression in IMAT than in OMAT in cows (p = 0.0042) and steers (p<0.0001) (Figure 3A and 3B). However, ALDOA had significantly (p<0.0001) lower expression in IMAT than in OMAT in bulls (Figure 3C). These results demonstrated that ALDOA was differentially expressed depending on sex, suggesting that ALDOA could be one of the factors affecting lipid accumulation in OMAT.

Western blot analysis for selected proteins

We found significant correlations between several factors (including tropomyosin [TPM] 1, TMP2, and TMP3) and gene expression in IMAT and OMAT. TPMs are a family of actin binding proteins in all tissues that are always associated with polymerized actin. TPMs are a diverse group of cytoskeletal proteins found in most eukaryotic cells, with distinct isoforms found in muscle (skeletal, cardiac, and smooth) and various non-muscle cells (Dlugosz et al., 1984; Lin and Lin, 1986). Previous studies have shown that TPM plays a critical role in skeletal muscle development and function (Marston et al., 2013; Zhang et al., 2014). Results of the mRNA levels (upper panels) and protein expression levels (lower panels) of TPM1, TPM2, and TPM3 are shown in Figure 4. Notably, transcriptional and protein levels of TPM1, TPM2, and TPM3 were significantly lower in IMAT of steers compared to cows or bulls. The mRNA and protein levels of TPM1, TPM2, and TPM3 were higher in OMAT of cows than in bulls. In addition, TPM1, TPM2, and TPM3 had higher expression in OMAT than in IMAT in cows and steers, but had lower expression in OMAT than IMAT in bulls. These results demonstrated that TPM1, TPM2, and TPM3 were differentially expressed depending on sex. Adipose depots and TPMs were positively correlated with marbling score and quality grade. Therefore, we suggest that TPM1, TPM2, and TPM3 are key factors closely associated with muscle development and lipid accumulation in Hanwoo cows, steers, and bulls.

Notes

CONFLICT OF INTEREST

We certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript.

ACKNOWLEDGMENTS

This work was carried out with the support of “Research Program for Agriculture Science & Technology Development (Project No. PJ01203102)” National Institute of Animal Science, Rural Development Administration, Republic of Korea.

Figure 1
Protein profiles of intramuscular adipose tissue (IMAT) and omental adipose tissue (OMAT) from Hanwoo cows, steers and bulls by image analysis. (A) Number, marbling score, and quality grade of individuals; (B) Overall patterns of total protein bands from individuals (1 to 21). Gels were visualized by sliver staining.
ajas-29-8-1197f1.gif
Figure 2
Ontological classification of differentially regulated proteins in intramuscular adipose tissue (IMAT) and omental adipose tissue (OMAT) from Hanwoo cows, steers and bulls. Of the 55 identified proteins, 44, 40, and 42 proteins were differentially expressed in IMAT of cows, steers, and bulls, respectively. In OMAT, 33, 33, and 22 were differentially expressed in cows, steers, and bulls, respectively (A) Identified proteins were clustered into eight categories based on their biological processes. Representative category of the 16 up- or down-regulated proteins between IMAT and OMAT of cows, steers, and bulls; (B) Depending on the reactome-pathway, the proteins were clustered into five categories; (C) Depending on the panther-biological processes, the proteins were clustered into six categories.
ajas-29-8-1197f2.gif
Figure 3
Gene expression levels on intramuscular adipose tissue (IMAT) and omental adipose tissue (OMAT) depending on sex. The quantitative differences of 16 genes at the transcriptional level were measured by real-time polymerase chain reaction in IMAT and OMAT from Hanwoo cows, steers, and bulls. TPM2, tropomyosin 2; ACTA1, actin, alpha 1, skeletal muscle; ALDOA, fructose-bisphosphate aldolase A; TPM1, tropomyosin 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LDHB, lactate dehydrogenase B; TPI1, triosephosphate isomerase 1; TPM3, tropomyosin 3; ENO3, enolase 3; CA3, carbonic anhydrase III; PGM1, phosphoglucomutase 1; LDHA, lactate dehydrogenase A; PGAM2, phosphoglycerate mutase 2; PYGM, phosphorylase, glycogen; PKM, pyruvate kinase; MDH1, malate dehydrogenase 1. Student’s t test was performed to evaluate statistical significance (*** p<0.0001; mean±standard error of the mean; n = 3).
ajas-29-8-1197f3.gif
Figure 4
Gene and protein expression levels of tropomyosin (TPM)1, TPM2, and TPM3 in intramuscular adipose tissue (IMAT) and omental adipose tissue (OMAT). The quantitative differences of (A) TPM1, (B) TPM2, and (C) TPM3 at the transcriptional and protein levels were measured by real-time polymerase chain reaction and western blot analysis. Student’s t test was performed to evaluate statistical significance (*** p<0.0001; mean±standard error of the mean; n = 3).
ajas-29-8-1197f4.gif
Table 1
Primer sequences used to generate templates for RT-PCR and real-time PCR
Gene name Symbol GenBank ID Primer sequence (5′→3′) Product size (bp)
Tropomyosin 2 TPM2 NM_001010995 F: CAT TCT GCT CCG GAT ATG GT
R: GCC GAG CTA CTT CAT TCT GG
211
Actin, alpha 1, skeletal muscle ACTA1 NM_174225 F: GAGCGTGGCTACTCCTTCGT
R: GGTGGCCATTTCGTTCTCAA
105
Aldolase A, fructose-bisphosphate ALDOA NM_001101915 F: CCACGCCTGTACCCAGAAAT
R: CTCCGGACAGGAAGGTGATC
110
Tropomyosin 1 TPM1 NM_001013590 F: GGATGCCGACCGCAAGTAT
R: GCACATTTGCCTTCTGAAAGC
105
Glyceraldehyde-3-phosphate dehydrogenase GAPDH NM_001034034 F: CATCTCCGCCACACTGAGAA
R: AAGGCAGGGCTCCCTAAGC
90
Lactate dehydrogenase B LDHB NM_174100 F: CAGTCCTGCCTGCATCATCA
R: TCACACGGTGCTTGGGTAATC
95
Triosephosphate isomerase 1 TPI1 NM_001013589 F: GAGAAGGTCGTTTTCGAGCAA
R: CAGTACCAATGGCCCACACA
100
Tropomyosin 3 TPM3 NM_001011674 F: CTGAGAGATCGGTAGCCAAGCT
R: CTCCTCGCTAATGGCCTTGT
95
Enolase 3 ENO3 NM_001034702 F: CCCGACAAGGTGGTGATTG
R: GCAGGGTCGTCAGGTGACTT
95
Carbonic anhydrase III CA3 NM_001034437 F: CACAGCGTGGATGGAGTCAA
R: TACCATCGGCATGCTTCAGA
100
Phosphoglucomutase 1 PGM1 NM_001076903 F: ACCCCAACTGGCTGGAAGTT
R: CACGGATGTGGTCAGAACCA
100
Lactate dehydrogenase A LDHA NM_174099 F: TCAGCTCGCTTCCGTTATCTC
R: CACCATGCTCCCCAAGGAT
85
Phosphoglycerate mutase 2 PGAM2 NM_001038111 F: ATCTGGAGGCGCTCCTTTG
R: CGCTCCTTGCTGATGGACTT
80
Phosphorylase, glycogen PYGM NM_175786 F: GGCCTGCTTTCTGGACTCAA
R: TGCCAACCCCCAGAGATCT
105
Pyruvate kinase PKM NM_001205727 F: CCTGCCTGCTGTGTCAGAAA
R: AAGCCTTGCGGATGAAAGAC
95
Malate dehydrogenase 1 MDH1 NM_001034628 F: TGGATGTGGCCATTCTTGTG
R: GCACCCTGGCATTTGAAGAT
100

PCR, polymerase chain reaction.

Table 2
Carcass characteristics among cows, steers, and bulls that were used in proteomic analysis
Variables Cows (n = 7) Steers (n = 7) Bulls (n = 7)
Age (mo) 31.43±0.30 31.67±0.16 31.56±0.24
Carcass weight (kg) 406.10±13.37b 452.60±12.28a 490.90±13.59a
Backfat thickness (mm) 19.14±1.90a 16.67±1.51a 7.67±1.48b
Rib-eye area (cm2) 90.57±2.45b 91.22±1.72b 100.90±3.46a
Yield index 61.47±1.47b 61.99±1.18b 67.95±0.97a
Yield grade1 142.90±20.20b 155.60±16.67b 277.78±14.70a
Marbling score2 4.71±0.47b 6.89±0.37a 1.00±0.00c
Quality grade3 32.86±1.84b 38.89±1.05a 10.00±0.00c

Mean±standard error of the mean.

a–c Means in row with different superscripts differ (p<0.05).

1 Yield grade: 300 = A, 200 = B, 100 = C.

2 Marbling score: 1 = trace, 9 = very abundant.

3 Quality grade: 40 = 1++ or 1+, 30 = 1, 20 = 2, 10 = 3.

Table 3
List of total proteins in cows, steers and bulls among identified proteins between IMAT and OMAT
No UniProt1 UniGene2 (NCBI) Protein identified Gene name pI3 MW (kDa)4 Seq. Cov (%)5 Individual ion score6

IMAT OMAT


Cows Steers Bulls Cows Steers Bulls
1 P02070 Bt.23726 Hemoglobin subunit beta HBB 7.59 15.9 73.79 55.48 46.92 47.67 145.82 218.33 141.46
2 Q5KR48 Bt.53077 Tropomyosin beta chain TPM2 4.7 32.8 62.68 90.86 84.76 146.88 6.92 5.24 0
3 P01966 Bt.10591 Hemoglobin subunit alpha HBA 8.44 15.2 62.68 11.59 4.08 4.07 39.4 58.1 34.55
4 P68138 Bt.88733 Actin, alpha skeletal muscle ACTA1 5.39 42 57.56 131.84 121.18 184.84 41.13 54.42 34.54
5 Q3T149 Bt.4415 Heat shock protein beta-1 HSPB1 6.4 22.4 56.72 24.45 10.58 46.52 46.03 45.34 32.87
6 A6QLL8 Bt.22533 Fructose-bisphosphate aldolase ALDOA 8.19 39.4 43.41 60.43 58.92 88.1 21.42 12.71 8
7 Q9XSC6 Bt.3651 Creatine kinase M-type CKM 7.12 43 39.9 40.7 55.66 111.25 0 0 0
8 Q5KR49 Bt.109484 Tropomyosin alpha-1 chain TPM1 4.74 32.7 39.44 79.5 72.94 116.58 6.92 5.24 0
9 F1MHQ4 Bt.97 Fatty acid-binding protein, adipocyte FABP4 5.66 14.6 39.39 0 5.73 0 35.8 33.58 25.77
10 P10096 Bt.87389 Glyceraldehyde-3-phosphate dehydrogenase GAPDH 8.35 35.8 39.04 31.57 41.42 78.81 4.86 5.48 5.5
11 P00171 Bt.65097 Cytochrome b5 CYB5A 5.03 15.3 32.09 4.3 0 0 6.18 0 0
12 Q5E9B1 Bt.7736 L-lactate dehydrogenase B chain LDHB 6.44 36.7 31.44 0 0 3.78 29.61 27.85 13.08
13 Q5E956 Bt.3487 Triosephosphate isomerase TPI1 6.92 26.7 31.33 9.57 20.36 30.91 2.97 3.06 0
14 Q5KR47 Bt.55987 Tropomyosin alpha-3 chain TPM3 4.72 32.8 30.99 44.91 43.73 72.02 6.92 5.24 0
15 Q3ZC09 Bt.49475 Beta-enolase ENO3 7.72 47.1 29.26 36.37 47.08 56.06 4.08 6.85 0
16 P02769 Bt.106669 Serum albumin ALB 6.18 69.2 28.67 109.86 79.13 110.46 269.73 283.92 213.15
17 Q3SZX4 Bt.49056 Carbonic anhydrase 3 CA3 7.84 29.4 26.54 21.82 33.88 46.14 0 0 0
18 F1N647 Bt.30099 Fatty acid synthase FASN 6.46 274.1 20.7 14.41 8.42 2.37 137.1 189.72 57.99
19 Q08DP0 Bt.59999 Phosphoglucomutase-1 PGM1 6.81 61.6 20.28 22.64 15.64 38.83 0 0 0
20 P19858 Bt.3809 L-lactate dehydrogenase A chain LDHA 8 36.6 18.67 16.69 22.01 35.86 0 2.11 4.31
21 F1N2F2 Bt.23217 Phosphoglycerate mutase 2 PGAM2 8.9 28.7 16.21 8.57 3.86 19.32 0 0 0
22 P00829 Bt.4431 ATP synthase subunit beta, mitochondrial ATP5B 5.27 56.2 15.34 11.48 4.89 11.38 19.53 17.88 10.08
23 F1MJ28 Bt.16003 Phosphorylase PYGM 7.11 97.2 15.32 26.9 27.38 49.74 0 0 0
24 A4IFB3 Bt.24903 PLIN protein PLIN 6.48 55 15.12 2.26 0 0 22.36 10.59 7.97
25 A5D984 Bt.40497 Pyruvate kinase PKM2 7.85 57.9 14.69 25.77 20 35.69 0 0 0
26 Q3T0P6 Bt.37560 Phosphoglycerate kinase 1 PGK1 8.27 44.5 14.15 21.27 23.79 28.73 6.91 2.59 0
27 P00570 Bt.4224 Adenylate kinase isoenzyme 1 AK1 8.32 21.7 13.4 0 0 10.91 0 0 0
28 A7Z057 Bt.107001 14-3-3 protein gamma YWHAG 4.89 28.3 13.36 5.63 6.21 4.93 15.39 18.16 8.32
29 A7E3W4 Bt.4750 Transketolase TKT 7.14 64.8 11.58 4.49 0 0 26.36 29.15 11.84
30 Q27965 Bt.49659 Heat shock 70 kDa protein 1B HSPA1B 5.92 70.2 11.08 10.32 7.47 18.99 16.86 17.4 7.77
31 F1MLB8 Bt.7194 ATP synthase subunit alpha ATP5A1 9.19 59.7 9.22 14.33 6.72 12.58 8.05 10.82 6.99
32 Q3ZBY4 Bt.49614 Fructose-bisphosphate aldolase ALDOC 6.65 39.4 9.07 18.16 17.87 24.52 6.22 4.62 0
33 Q3ZBD7 Bt.49587 Glucose-6-phosphate isomerase GPI 7.71 62.8 8.62 7.58 2.57 9.5 3.34 0 0
34 Q3T100 Bt.1157 Microsomal glutathione S-transferase 3 MGST3 9.54 16.9 8.55 2.99 0 0 5.93 3.05 3.63
35 F1MB08 Bt.22783 Alpha-enolase ENO1 6.8 47.3 8.53 18.17 10.23 15.29 4.08 6.85 0
36 P42028 Bt.5483 NADH dehydrogenase NDUFS8 6.87 23.9 8.02 2.09 4.12 0 0 0 0
37 P13696 Bt.59089 Phosphatidylethanolamine-binding protein 1 PEBP1 7.49 21 7.49 0 2.84 2.91 4.85 5.79 0
38 P19120 Bt.12309 Heat shock cognate 71 kDa protein HSPA8 5.52 71.2 7.38 8.51 5.57 6.4 12.02 9.82 3.82
39 F1N7W0 Bt.15246 Uncharacterized protein MGC152281 8.79 36.2 7.27 0 2.3 0 0 0 0
40 P15690 Bt.4777 NADH-ubiquinone oxidoreductase 75 kDa subunit NDUFS1 6.15 79.4 6.74 0 2.57 0 0 0 0
41 P00432 Bt.48925 Catalase CAT 7.28 59.9 6.45 2.12 0 0 8.86 9.6 10.08
42 Q8MKH7 Bt.11215 Troponin T fast skeletal muscle type TNNT3 8.1 29.8 6 0 0 5.92 0 0 0
43 Q0V7M4 Bt.46979 Calcium-binding mitochondrial carrier protein SCaMC-2 SLC25A25 8.43 52.7 5.97 3.39 0 3.4 0 0 0
44 F1MGE7 Bt.62768 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 ATP2A1 5.27 109.2 5.74 8.57 10.49 12.02 0 0 0
45 Q08DM3 Bt.6984 Malic enzyme ME2 7.65 65.4 5.31 0 0 2.37 0 0 0
46 Q1LZ96 Bt.59430 ATP synthase mitochondrial F1 complex assembly factor 2 ATPAF2 7.46 32.8 4.15 0 7.41 5.64 0 0 0
47 G1K1H1 Bt.7915 Malate dehydrogenase MDH2 9.7 29.9 3.97 2.27 0 0 2.37 2.18 0
48 E1BLB2 Bt.29035 Uncharacterized protein TNFAIP1 7.84 36.1 3.8 2.21 0 0 0 2.17 0
49 Q5E9C1 Bt.16018 Caspase-4 CASP4 6.18 43 3.71 2.23 2.25 4.29 0 0 0
50 Q29RL6 Bt.46395 Uncharacterized protein VAT1L 5.1 45.8 3.58 3.77 0 0 0 0 0
51 Q8MKH6 Bt.4160 Troponin T, slow skeletal muscle TNNT1 5.87 31.3 3.42 2.07 5.48 3.78 0 0 0
52 P02453 Bt.23316 Collagen alpha-1(I) chain COL1A1 5.78 138.9 3.42 6.11 4.35 8.69 0 3.35 2.86
53 F1MYC8 Bt.3961 Calpain-3 CAPN3 6.29 82.6 3.39 4.6 0 0 2.36 4.66 4.79
54 Q3T145 Bt.5345 Malate dehydrogenase, cytoplasmic MDH1 6.58 36.4 2.99 0 0 4.41 0 0 0
55 G5E6M7 Bt.24449 Succinate dehydrogenase SDHA 7.62 73.2 2.11 2.92 0 0 3.01 3.19 0

IMAT, intramuscular adipose tissue; OMAT, omental adipose tissue.

1 UniProt, accession number in the UniProt database.

2 UniGene: UniGene number from NCBI (National Center for Biotechnology Information) database.

3 pI, isoelectric point of the protein.

4 MW (kDa), molecular weight of the protein.

5 Seq. Cov (%), percentage of sequence coverage.

6 Individual ion score, TurboSEQUEST or gMASCOT score.

Table 4
Reactome pathway related proteins in cows, steers and bulls among identified proteins between IMAT and OMAT
No UniProt1 UniGene2 (NCBI) Protein identified Gene name pI3 MW (kDa)4 Seq. Cov (%)5 Individual ion score6

IMAT OMAT


Cows Steers Bulls Cows Steers Bulls
Metabolism of carbohydrates
 1 Q3SZX4 Bt.49056 Carbonic anhydrase 3 CA3 7.84 29.4 26.54 21.82 33.88 46.14 0 0 0
 2 Q08DP0 Bt.59999 Phosphoglucomutase-1 PGM1 6.81 61.6 20.28 22.64 15.64 38.83 0 0 0
 3 F1MJ28 Bt.16003 Phosphorylase PYGM 7.11 97.2 15.32 26.9 27.38 49.74 0 0 0
 4 Q3T145 Bt.5345 Malate dehydrogenase, cytoplasmic MDH1 6.58 36.4 2.99 0 0 4.41 0 0 0
Integration of energy metabolism/Diabetes pathways
 5 A6QLL8 Bt.22533 Fructose-bisphosphate aldolase A ALDOA 8.19 39.4 43.41 60.43 58.92 88.1 21.42 12.71 8
 6 P10096 Bt.87389 Glyceraldehyde-3-phosphate dehydrogenase GAPDH 8.35 35.8 39.04 31.57 41.42 78.81 4.86 5.48 5.5
 7 Q5E956 Bt.3487 Triosephosphate isomerase TPI1 6.92 26.7 31.33 9.57 20.36 30.91 2.97 3.06 0
 8 Q3ZC09 Bt.49475 Beta-enolase ENO3 7.72 47.1 29.26 36.37 47.08 56.06 4.08 6.85 0
 9 F1N2F2 Bt.23217 Phosphoglycerate mutase 2 PGAM2 8.9 28.7 16.21 8.57 3.86 19.32 0 0 0
 10 A5D984 Bt.40497 Pyruvate kinase PKM2 7.85 57.9 14.69 25.77 20 35.69 0 0 0
Muscle development
 11 Q5KR48 Bt.53077 Tropomyosin beta chain TPM2 4.7 32.8 62.68 90.86 84.76 146.88 6.92 5.24 0
 12 P68138 Bt.88733 Actin, alpha skeletal muscle ACTA1 5.39 42 57.56 131.84 121.18 184.84 41.13 54.42 34.54
 13 Q5KR49 Bt.109484 Tropomyosin alpha-1 chain TPM1 4.74 32.7 39.44 79.5 72.94 116.58 6.92 5.24 0
 14 Q5KR47 Bt.55987 Tropomyosin alpha-3 chain TPM3 4.72 32.8 30.99 44.91 43.73 72.02 6.92 5.24 0
TCA cycle
 15 Q5E9B1 Bt.7736 L-lactate dehydrogenase B chain LDHB 6.44 36.7 31.44 0 0 3.78 29.61 27.85 13.08
 16 P19858 Bt.3809 L-lactate dehydrogenase A chain LDHA 8 36.6 18.67 16.69 22.01 35.86 0 2.11 4.31

IMAT, intramuscular adipose tissue; OMAT, omental adipose tissue; TCA, tricarboxylic acid.

1 UniProt, Accession number in the UniProt database.

2 UniGene, UniGene number from NCBI (National Center for Biotechnology Information) database.

3 pI, isoelectric point of the protein.

4 MW (kDa), molecular weight of the protein.

5 Seq. Cov (%), percentage of sequence coverage.

6 Individual ion score, TurboSEQUEST or gMASCOT score.

REFERENCES

Arnold AM, Peralta JM, Thonney ML. 1996. Ontogeny of growth hormone, insulin-like growth factor-I, estradiol and cortisol in the growing lamb: Effect of testosterone. J Endocrinol 150:391–399.
crossref pmid
Choy YH, Park BH, Choi TJ, Choi JG, Cho KH, Lee SS, Choi YL, Koh KC, Kim HS. 2012. Estimation of relative economic weights of hanwoo carcass traits based on carcass market price. Asian Australas J Anim Sci 25:1667–1673.
crossref pmid pmc
Colbert MC, Ciejek-Baez E. 1988. Alternative promoter usage by aldolase A during in vitro myogenesis. Dev Biol 130:392–396.
crossref pmid
Destefanis G, Brugiapaglia A, Barge MT, Lazzaroni C. 2003. Effect of castration on meat quality in Piemontese cattle. Meat Sci 64:215–218.
crossref pmid
Dlugosz AA, Antin PB, Nachmias VT, Holtzer H. 1984. The relationship between stress fiber-like structures and nascent myofibrils in cultured cardiac myocytes. J Cell Biol 99:2268–2278.
crossref pmid pmc
Enns DL, Iqbal S, Tiidus PM. 2008. Oestrogen receptors mediate oestrogen-induced increases in post-exercise rat skeletal muscle satellite cells. Acta Physiol (Oxf) 194:81–93.
crossref pmid
Fritsche S, Steinhart H. 1998. Differences in natural steroid hormone patterns of beef from bulls and steers. J Anim Sci 76:1621–1625.
crossref pmid
Gondret F, Guitton N, Guillerm-Regost C, Louveau I. 2008. Regional differences in porcine adipocytes isolated from skeletal muscle and adipose tissues as identified by a proteomic approach. J Anim Sci 86:2115–2125.
crossref pmid
Guo B, Kongsuwan K, Greenwood PL, Zhou G, Zhang W, Dalrymple BP. 2014. A gene expression estimator of intramuscular fat percentage for use in both cattle and sheep. J Anim Sci Biotechnol 5:35.
crossref pmid pmc
Hausman GJ, Poulos SP, Richardson RL, Barb CR, Andacht T, Kirk HC, Mynatt RL. 2006. Secreted proteins and genes in fetal and neonatal pig adipose tissue and stromal-vascular cells. J Anim Sci 84:1666–1681.
crossref pmid
Hidaka K, Yamamoto I, Arai Y, Mukai T. 1993. The MEF-3 motif is required for MEF-2-mediated skeletal muscle-specific induction of the rat aldolase A gene. Mol Cell Biol 13:6469–6478.
crossref pmid pmc
Hughes JM, Oiseth SK, Purslow PP, Warner RD. 2014. A structural approach to understanding the interactions between colour, water-holding capacity and tenderness. Meat Sci 98:520–532.
crossref pmid
Inoue K, Yamasaki S, Fushiki T, Okada Y, Sugimoto E. 1994. Androgen receptor antagonist suppresses exercise-induced hypertrophy of skeletal muscle. Eur J Appl Physiol Occup Physiol 69:88–91.
crossref pmid
Jeong J, Bong J, Kim GD, Joo ST, Lee HJ, Baik M. 2013. Transcriptome changes favoring intramuscular fat deposition in the longissimus muscle following castration of bulls. J Anim Sci 91:4692–4704.
crossref pmid
Jeong J, Kwon EG, Im SK, Seo KS, Baik M. 2012. Expression of fat deposition and fat removal genes is associated with intramuscular fat content in longissimus dorsi muscle of Korean cattle steers. J Anim Sci 90:2044–2053.
crossref pmid
Kahlert S, Grohe C, Karas RH, Lobbert K, Neyses L, Vetter H. 1997. Effects of estrogen on skeletal myoblast growth. Biochem Biophys Res Commun 232:373–378.
crossref pmid
Lee DK. 2002. Androgen receptor enhances myogenin expression and accelerates differentiation. Biochem Biophys Res Commun 294:408–413.
crossref pmid
Lee DM, Bajracharya P, Lee EJ, Kim JE, Lee HJ, Chun T, Kim J, Cho KH, Chang J, Hong S, Choi I. 2011. Effects of gender-specific adult bovine serum on myogenic satellite cell proliferation, differentiation and lipid accumulation. In : In Vitro Cell Dev. Biol. Anim.; 47:438–444.
crossref
Lee SH, Park EW, Cho YM, Kim SK, Lee JH, Jeon JT, Lee CS, Im SK, Oh SJ, Thompson JM, Yoon D. 2007. Identification of differentially expressed genes related to intramuscular fat development in the early and late fattening stages of hanwoo steers. J Biochem Mol Biol 40:757–764.
crossref pmid
Lin JJ, Lin JL. 1986. Assembly of different isoforms of actin and tropomyosin into the skeletal tropomyosin-enriched microfilaments during differentiation of muscle cells in vitro. J Cell Biol 103:2173–2183.
crossref pmid pmc
Maltin C, Balcerzak D, Tilley R, Delday M. 2003. Determinants of meat quality: tenderness. Proc Nutr Soc 62:337–347.
crossref pmid
Marston S, Memo M, Messer A, Papadaki M, Nowak K, McNamara E, Ong R, El-Mezgueldi M, Li X, Lehman W. 2013. Mutations in repeating structural motifs of tropomyosin cause gain of function in skeletal muscle myopathy patients. Hum Mol Genet 22:4978–4987.
crossref pmid pmc
Nishimura T. 2010. The role of intramuscular connective tissue in meat texture. Anim Sci J 81:21–27.
crossref pmid
Park GB, Moon SS, Ko YD, Ha JK, Lee JG, Chang HH, Joo ST. 2002. Influence of slaughter weight and sex on yield and quality grades of Hanwoo (Korean native cattle) carcasses. J Anim Sci 80:129–136.
crossref pmid
Peachey BM, Purchas RW, Duizer LM. 2002. Relationships between sensory and objective measures of meat tenderness of beef m. longissimus thoracis from bulls and steers. Meat Sci 60:211–218.
crossref pmid
Purchas RW, Burnham DL, Morris ST. 2002. Effects of growth potential and growth path on tenderness of beef longissimus muscle from bulls and steers. J Anim Sci 80:3211–3221.
crossref pmid
Purslow PP. 2005. Intramuscular connective tissue and its role in meat quality. Meat Sci 70:435–447.
crossref pmid
Ren H, Li L, Su H, Xu L, Wei C, Zhang L, Li H, Liu W, Du L. 2011. Histological and transcriptome-wide level characteristics of fetal myofiber hyperplasia during the second half of gestation in Texel and Ujumqin sheep. BMC Genomics 12:411.
crossref pmid pmc
Schreurs NM, Garcia F, Jurie C, Agabriel J, Micol D, Bauchart D, Listrat A, Picard B. 2008. Meta-analysis of the effect of animal maturity on muscle characteristics in different muscles, breeds, and sexes of cattle. J Anim Sci 86:2872–2887.
crossref pmid
Sinha-Hikim I, Roth SM, Lee MI, Bhasin S. 2003. Testosterone-induced muscle hypertrophy is associated with an increase in satellite cell number in healthy, young men. Am J Physiol Endocrinol Metab 285:E197–205.
crossref pmid
Walsh TP, Winzor DJ, Clarke FM, Masters CJ, Morton DJ. 1980. Binding of aldolase to actin-containing filaments. Evidence of interaction with the regulatory proteins of skeletal muscle. Biochem J 186:89–98.
crossref pmid pmc
Walter LJ, Gasch CA, McEvers TJ, Hutcheson JP, Defoor P, Marquess FL, Lawrence TE. 2014. Association of pro-melanin concentrating hormone genotype with beef carcass quality and yield. J Anim Sci 92:325–331.
crossref pmid
Wilting SM, van Boerdonk RA, Henken FE, Meijer CJ, Diosdado B, Meijer GA, le Sage C, Agami R, Snijders PJ, Steenbergen RD. 2010. Methylation-mediated silencing and tumour suppressive function of hsa-miR-124 in cervical cancer. Mol Cancer 9:167.
crossref pmid pmc
Yan JX, Wait R, Berkelman T, Harry RA, Westbrook JA, Wheeler CH, Dunn MJ. 2000. A modified silver staining protocol for visualization of proteins compatible with matrix-assisted laser desorption/ionization and electrospray ionization-mass spectrometry. Electrophoresis 21:3666–3672.
crossref pmid
Zhang HM, Su YF, Shi ZY, Fu YS. 2014. cDNA clone and expression analysis of alpha-Tropomyosin during Japanese flounder (Paralichthys olivaceus) metamorphosis. Dongwuxue Yanjiu 35:307–312.
crossref pmid pmc
Zuo X, Echan L, Hembach P, Tang HY, Speicher KD, Santoli D, Speicher DW. 2001. Towards global analysis of mammalian proteomes using sample prefractionation prior to narrow pH range two-dimensional gels and using one-dimensional gels for insoluble and large proteins. Electrophoresis 22:1603–1615.
crossref pmid
TOOLS
METRICS Graph View
  • 7 Crossref
  • 9 Scopus
  • 14,403 View
  • 164 Download
Related articles


Editorial Office
Asian-Australasian Association of Animal Production Societies(AAAP)
Room 708 Sammo Sporex, 23, Sillim-ro 59-gil, Gwanak-gu, Seoul 08776, Korea   
TEL : +82-2-888-6558    FAX : +82-2-888-6559   
E-mail : editor@animbiosci.org               

Copyright © 2026 by Asian-Australasian Association of Animal Production Societies.

Developed in M2PI

Close layer
prev next