Oral palate mucosa materials were collected by scrapping oral palate from four healthy wild Argali and stored in Trizol (Invitrogen, Beijing, China). Total RNA was extracted by using the Trizol (Invitrogen, China) method and stored at −70°C until use.

The 5′ ends were generated according to the instructions for the 5′ Full RACE Core Set cDNA Kit (Clontech, Beijing, China). Briefly, cDNA was synthesized by reverse transcription (RT) UPM primer (as provided in the kit). Based on the published mRNA sequence of Bos taurus (accession no. NM_174426.3), gene specific primers namely R2 (5′ATTGACCAGNGGGCAC AC3′) and K2(5′CAGGCTGCCAGGGGAGTG3′) were employed in the nested polymerase chain reaction (PCR) at concentration of 20 pmol/μL each. The second amplification products were recovered using ‘Takara Agarose gel DNA purification Kit version 2.0’ according to the manufacturer’s instructions and ligated into pMD-18T cloning vector (Takara Biotechnology, Dalian, China) as described [6]. The sequences in the clones were verified by the sanger DNA sequencing method using Taq DNA Polymerase (Qiagen, Shanghai, China).

The 3′ends were synthesized according to the instructions in 3′Full RACE Core Set cDNA Kit (Takara Biotechnology, China). The 3-sites adapter Primer (provided in the Kit), the P1 primer (5′CATCGTCTCTATGTCACC3′) and P2 primer (5′ATTGAC CAGNGGGCACAC3′) were used at concentration of 20 pmol/μL each. The 3′ end PCR products were purified and ligated into pMD-18T cloning vector (Takara Biotechnology, China). The sequences in the clones were verified by the Sanger DNA sequencing method using Taq DNA Polymerase (Qiagen, China).

The complete coding sequence was generated by RT-PCR as described [6]. The primers used were as follows: SPB1(5′TACGTAATGCACCACCACCACCACCACCTGCTAGAAGCCCT GCCCG3′); SPB2(5′GCGGCCGCTCAGACTTTGATGACAAATTCTAGCCC3′) at concentrations of 20 pmol/μL each. The purified PCR products were ligated into pMD-18T cloning vector (Takara Biotechnology, China). The sequences in the clones were verified by the Sanger DNA sequencing method using Taq DNA Polymerase (Qiagen, China).

The expression vector of recombinant SPLUNC1 protein was constructed by inserting full length SPLUNC1 open reading frame (ORF) into pPIC9K plasmid (Invitrogen, China). Briefly, recombinant pMD-18T with SPLUNC1 ORF was digested with SnaB I and Not I and the SPLUNC1 cDNA fragment was inserted into pPIC9K vector previously linearized with similar enzymes to obtain the pPIC9K/SPLUNC1 cDNA expression vector. The recombinant vector was transformed into Escherichia coli and eight positive clones were verified by enzyme digestion. The recombinant pPIC9K/SPLUNC1 vector was linearized by using Sac I and transformed into Pichia pastoris GS115 by using electroporation-mediated method. His+ transformants were selected on minimal dextrose (MD) plates and selected subsequently on yeast extract peptone dextrose (YPD) plates containing gentamycin 418 (G418; 0.25 to 3 mg/mL), and the genomic DNA of the His+ and G418+ transformants were extracted and analyzed by PCR using the 5′AOX1 primer and the 3′AOX1 primer.

A monoclonal strain that was picked from plate G418 was inoculated into BMGY medium [BMGY: 20 g tryptone, 10 g yeast extract, 100 mL 10×yeast nitrogen base (YNB W/O amino acids), 2 mL 500×D-Biotin (B), 100 mL 10× glycerol (Gl), 100 mL 1 M phosphate buffer, 700 mL H₂O], and cultured for 2 days (OD600 = 2–6) in the shaker. Pichia pastoris liquid was centrifuged. Then, it was transferred into BMMY medium [BMMY: 20 g tryptone, 10 g yeast extract, 100 mL 10×YNB, 2 mL 500×B, 100 mL 10× methanol (M), 100 mL 1 M phosphate buffer, 700 mL H₂O], which was used for inducing protein expression. Methanol was added to a final concentration of 0.5% (v/v) every 24 h. After 3 days, yeast liquid was collected and centrifuged. Finally, the supernatant was collected separately and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

Following induction, the supernatant were collected were isolated as described by the manufacturer (Qiagen, China). Briefly, yeast liquid which contained the expression product was collected by centrifugation and the supernatant collected. The supernatant was filtered through a 0.22 μm membrane. The filtrate was passed through a Ni-NTA agarose affinity chromatography column with 10 to 15 volumes of binding buffer (pH 8.0 50 mM phosphate buffer containing 0.5 M NaCl and 20 mM imidazole) until the optical density (OD) value reached the 280 nm absorbance, and was collected respectively. Then, it was eluted with elution buffer (pH 8.0 50 mM phosphate buffer containing 0.5 M NaCl and 300 mM imidazole). Finally, the liquid effluent was collected separately and analyzed by SDS- PAGE [7].

After the process of SDS-PAGE electrophoresis, the proteins were electroblotted to polyvinylidene fluoride membrane. Then the membrane was placed in blocking solution about 1 h; incubated at 4°C overnight with Murine monoclonal antibody with anti-His tag (1:2,000), next, the membrane was washed 3 times with Tris-buffered saline and Tween 20 (TBST) (TBST: 50 mL 1 M pH 7.5 Tris HCl, 8 g NaCl, 0.2 g KCl, 0.5 mL Tween 20, 1,000 mL H₂O). Incubated at 25°C with the secondary antibody, horseradish peroxidase labeled goat anti-mouse IgG (1:5,000), for about 90 min, then the membrane was washed three times with TBST, and finally colored with diaminobenzidine coloring solution.

Determination of the activity of the expression product of SPLUNC1 was tested by incubating MO, 10⁵ colony-forming units (CFUs)/mL, with recombinant SPLUNC1 (make the final concentration of recombinant SPLUNC1 protein up to 1 μg/mL, 3 μg/mL, 10 μg/mL in every well), phosphate-buffered saline (PBS) (as control) in a 24-well plate for 48 hours at 37°C as described [8,9]. MO RNA was extracted, and real-time PCR was performed to quantify MO 16S rRNA levels. Finally, statistical analysis was carried out for the data by using one-way analysis of variance by SPSS17.0 (www.xpgod.com).

Nucleotide sequencing combined with a search of the GenBank database revealed eight clones generated by 5′RACE-PCR (≈635) (Figure 1A), having no initiator element in their open reading frames. The 3′RACE-PCR products (Figure 1B) had complete 3′ends containing polyadenylation tail of 12A’s at 224 bp downstream of the stop codon TAA. All the transformation clones had inserts of the expected SPLUNC1 cDNA-ORF as identified by SnaB I and Not I enzyme digestion (Figure 2A). The sequences were confirmed in all the nine clones. The 3′, 5′RACE and full length sequences were 635 bp (3′ends), 620 bp (5′ends), and 1,076 bp (SPLUNC1 cDNA) respectively, each having 99% identity to Ovis.aries mRNA.

The sequence of Wild Argali SPLUNC1 cDNA and the inferred amino acids was shown in Figure 2B. The accuracy of the sequence was determined on both strands and found to be in order. The cDNA insert was 1,076 bp long. SPLUNC1 cDNA-ORF contains one long open reading frame of 768 bp from 64 nt to 831 nt. The first methionine codon ATG begins at 64 to 66 nt and ends at presumed stop codon TAA at 829 to 831 nt. The bases AATAAA at 1,034 to 1,039 nt downstream are the distal polyadenylation stop signals for SPLUNC1 cDNA. However, the TATA box was not found in the upstream of SPLUNC1 cDNA-ORF.

The initial ATG and stop TAG codons are shaded. The distal polyadenylation signal sequence AATAAA are shaded. The nucleotide and its amino acids are numbered along the left margins respectively.

The open reading frame encoded a 255 amino acid residue protein with an isoelectric point (pI) of 5.07 and a predicted molecular mass of 26,486.43 Da (≈26.49 kDa). The recombinant protein corresponded to the expected molecular mass of 25.47 kDa as judged by SDS-PAGE and the expression product was detected in the supernatant of the Pichia pastoris (Figures 3A, B). The protein consists of 118 hydrophobic amino acids (Ala, Ile, Leu, Phe, Trp, and Val), 57 Polar amino acids (Asn, Cys, Gln, Ser, Thr, and Tyr), 12 strongly basic amino acids (Lys and Arg) and 19 strongly acidic amino acids (aspartic acid [Asp] and glutamic acid [Glu]). Alignment of amino acid sequences of SPLUNC1 cDNA against amino acid sequences from other species revealed SPLUNC1 protein shared 98.4%, 96.9%, 94.5%, 90.2%, 80.8%, 78.4%, 78.3%, 72.5%, 72.3%, 68.8% identity with those of SPLUNC1 cDNA from Ovis aries (accession no. NP_ 001288334.1), Capra hircus (accession no. XP_005688516.1), Pantholops hodgsonii (accession no. XP_005979709.1), Bos taurus (accession no. NP_776851.1), Felis catus (accession no. XP_0069 29910.1), Homo sapiens (accession no. NP_001230122.1), Sus scrofa (accession no. NP_001005727.1), Chinchilla lanigera (accession no. NP_001269294.1), Mus musculus (accession no. NP_035256.2), and Rattus norvegicus (accession no. NP_742028.1), respectively (Figure 4). The phylogenetic tree generated from nucleotide sequences (Figure 4) revealed a close relationship between Argali and Ovis aries.

The results showed that a distinct protein bands appeared at 25.47 KDa place (Figure 5) and the recombinant proteins can bind specifically His tag antibody by Western blot analysis, so the expression of recombinant SPLUNC1 protein was confirmed.

The results from the test of recombination SPLUNC1 protein on MO showed that the expression product could inhibit MO proliferation very well (p<0.01), which proved the expressed protein had biological activity (Figure 3C).