Porcine genomic DNA was extracted from the ear tissues of three-way crossbreds (LWD) obtained at the slaughterhouse. LA-PCR (Long and Accurate PCR) was conducted to identify the porcine β-casein genomic DNA as follows using primers prepared based on the porcine β-casein promoter region (Accession No. AY452035) reported to the NCBI and the result of cDNA analysis. The primers for PCR were as follows; porcine β-casein promoter sense primer (CCCACTATTTCCTGATTCTTGA TTAACTTT), exon 6 antisense primer (TGTTGTTCCT CCCGCTTTAGCTTCTCAATT), exon 2 sense primer (GACTTGATCGCCATGAAGCTCCTCATCCTT) and exon 9 antisense primer (GCCTAAGGATTAATTTATTG AAATGACTGG). PCR was conducted using 100 ng of the genomic DNA extracted from porcine ear tissues with 10 pmol of sense and antisense primers, 0.5 U i-Max II DNA polymerase (Intron, Korea), 1×PCR buffer and 200 μM dNTP mixture as follows: 2 min of initial denaturation at 94°C followed by 30 cycles of 94°C for 30 s, 63°C for 30 seconds, 72°C for 7 min and 30 s, followed by a final elongation step at 72°C for 15 min. The PCR products were confirmed by electrophoresis on 0.8% agarose gel, after which they were cloned into the pGEM T-easy vector (Promega, USA). Sequencing was conducted using an ABI PRISM 377 sequencer. The nucleotide sequence was analyzed by Genetyx-win (version 4.0).

To test for promoter activity, the 5′-flanking region containing promoter with and without intron 1 was fused to the firefly luciferase gene in pGV-B2 (TOYO INK MFG, Japan) as follows. For construction of luciferase vector containing only promoter (−2,657 to +39) of porcine βcasein gene, PCR was conducted using porcine β-casein 5′ arm DNA containing normal TATA or mutant TATA box as a template. A sense primer (CCCACTATTTCCTGATT CTTGATTAACTTT) and antisense primer (CTCGAGTCC AAAGTGGAGGACAAGAAGTGA) containing the XhoI restriction enzyme site were designed for ligation in the multi cloning site of pGV-B2 vector. PCR was conducted using 10 pg of DNA and 10 pmol of sense and antisense primers, 1×PCR buffer, 0.5 unit of i-MaxII polymerase (Intron, Korea) and 200 μM of dNTP mixture. PCR was conducted under the following conditions: 2 min of initial denaturation at 94°C, followed by 35 cycles of 94°C for 30 s, 62°C for 30 s, 72°C for 4 min and a final elongation step at 72°C for 15 min. PCR products were ligated with pGEM T-easy vector to generate pGEM-β-Promoter plasmid (Promega, USA). Inserts were prepared by digestion of pGEM-β-Promoter plasmid with EcoRV and XhoI restriction enzyme. pGV-B2 vector was prepared by digestion of the SmaI and XhoI restriction sites, after which it was ligated with an insert containing normal TATA or mutant TATA box from pGEM-β-Promoter plasmid (denoted pβCE1TATA and pβCE1mTATA, respectively). For construction of luciferase vector containing promoter and intron 1 (−2,657 to +2,450) of porcine β-casein, PCR was conducted using porcine β-casein 5′ arm DNA containing normal TATA or mutant TATA box as a template. For cloning in pGV-B2 vector, sense primer (CCCACTA TTTCCTGATTCTTGATTAACTTT) and antisense primer (CCATGGCGATCAAGTCCTGTGAATGGGGAA) containing the NcoI restriction enzyme site were designed. PCR was conducted with 10 pg of DNA using 10 pmol of sense and antisense primers, 1×PCR buffer, 0.5 unit of i-MaxII polymerase (Intron, Korea) and 200 μM of dNTP mixture. PCR was conducted under the following conditions: 2 min of initial denaturation at 94°C followed by 35 cycles of 94°C for 30 s, 62°C for 30 s, and 72°C for 5 min, with a final elongation step at 72°C for 15 min. PCR products were ligated with pGEM T-easy vector to generate pGEM-β-intron1 plasmid (Promega, USA). Inserts were prepared by digestion of pGEM-β-intron1 plasmid with SmaI and NcoI restriction enzyme. Inserts were subcloned into the vector pGV-B2 to generate pβCE2TATA and pβCE2mTATA luciferase vector.

For luciferase vector transfection, pCMV β-galactosidase plasmid (Clontech, USA) was used for normalization. Transfection was conducted as follows. HC11 cells were inoculated on a 96 well plate at a density of 1×10⁴ cells and the culture medium was replaced with fresh medium the next day. The cells were then transfected using jetPEI transfection reagent (Polyplus-transfection, France) according to the manufacturer’s instruction. Luciferase vector (0.05 pmol) and pCMV-β-gal plasmid (0.02 pmol) were used. In the transfection experiment, parallel plates of cells were transfected with pGVB2 and pGV-P2, which served as negative and positive controls, respectively. The plasmid pGV-B2 lacks a eukaryotic promoter; therefore, no luciferase activity was detected in cells transfected with pGV-B2. The plasmid pGV-P2 contains the SV40 early promoter, which drives expression of the luciferase gene. The transfection efficiency was assayed by co-transfection with the β-galactosidase reporter, pCMV β-gal.

After the transfection, cells were cultured for 24 h. The culture medium was replaced with serum free medium for 48 hours with hormone treatment. Hormone treatment was conducted using 5 μg/ml insulin (Sigma, USA), 1 μM dexamethasone (Sigma, USA), and 5 μg/ml prolactin (Sigma, USA) in serum free RPMI 1640 (HyClone, USA) for 48 hours. The negative control was not treated with hormones.

After hormone treatment for 48 hours, the cells were washed two times with 1×PBS and then lysis buffer (50 μl) was added into cells. The cell lysates were transferred to 1.5 ml tubes. After collection, cells were immediately put into the liquid nitrogen. Frozen cells were then thawed at 37°C and centrifuged at 12,000 rpm and 4°C for 2 min, after which the supernatant was collected. For measurement of the luciferase activity, 20 μl supernatant and 50 μl of Luciferase Assay System with Reporter Lysis Buffer (Promega, USA) were added to a 96 well plate and analyzed using a GloMax 96 microplate Luminometer with single reagent injector (Promega, USA) according to manufacturer’s instructions. The transfection efficiency was determined by co-transfection with the β-galactosidase reporter, pCMV β-gal. β-galactosidase activity was measured using a chemiluminescence assay kit (Promega, USA) according to the manufacturer’s instructions. The relative light units were calculated by normalizing the firefly luciferase activity against the β-galactosidase activity to evaluate the transfection activity.

To identify the β-casein gene in porcine cells, LA-PCR was conducted using two pairs of β-casein specific primers and porcine genomic DNA as template. PCR products containing promoter-exon 6 and exons 2–9 were amplified with 6.8 kb and 5.5 kb (data not shown). Figure 1 summarizes the genomic organization of the porcine β-casein gene. Exon 1 encoded the 5′-UTR, while exon 2 contained the translational initiator codon AUG. Exon 8 contained the translation termination codon and exon 9 contained the 3′-UTR. The sequence reported in this paper has been deposited in the GenBank database under accession no. EU242520.

All intron/exon splice junctions conformed to the GT/AG rule. As shown in Table 1, exon 1 was 45 bp, exon 2 was 63 bp, exon 3 was 27 bp, exon 4 was 27 bp, exon 5 was 24 bp, exon 6 was 45 bp, exon 7 was 519 bp, exon 8 was 42 bp, and exon 9 was 306 bp. With the exception of exon 7 and exon 9, all other exons very short. Additionally, intron 1 was 2,398 bp, intron 2 was 735 bp, intron 3 was 118 bp, intron 4 was 1,325 bp, intron 5 was 94 bp, intron 6 was 1,307 bp, intron 7 was 606 bp, and intron 8 was 734 bp. These results confirmed that the β-casein genome comprising exon 1 - exon 9 was 8,410 bp in length. The promoter region was 3,107 bp, so the entire length of the identified β-casein region containing the promoter was 11,517 bp. Furthermore, we were isolated the β-casein gene containing the mutant TATA box (CATAAAA) by LA-PCR of samples from another individual pig (Figure 2A).

To determine the transcriptional activity of the 5′-proximal region and intron 1 of the porcine β-casein gene in HC 11 cells by lactogenic hormones, the genomic DNA fragments containing the 5′-flanking region −2,657 to +39 (pβCE1TATA) and −2,657 to +2,450 containing intron 1 (pβCE2TATA) were fused to the luciferase gene pGV-B2. Moreover, the luciferase vectors were constructed from genomic DNA containing mutant TATA with the 5′-flanking region −2,657 to +39 (pβCE1mTATA) and −2,657 to +2,450 containing intron 1 (pβCE2mTATA) to validate the necessity of the normal or mutant TATA box in the promoter for expression of the β-casein gene.

The luciferase activity of the pβCE1TATA and pβCE1mTATA without intron 1 were very low when compared with the positive control pGV-P2. The luciferase activity of pβCE1TATA and pβCE1mTATA were 0.042 and 0.06, respectively. However, when lactogenic hormone was added, the luciferase activity of pβCE1TATA and pβCE1mTATA were 0.26 and 0.112, respectively. Moreover, the luciferase activity of pβCE1TATA was increased when compared with pβCE1mTATA in the hormone treatment or non-treatment group. pβCE2mTATA and pβCE2TATA containing intron 1 of the porcine β-casein gene showed remarkably high luciferase activity when compared with pβCE1TATA and pβCE1mTATA without intron 1 in the hormone treatment or non treatment group. A high luciferase activity (4.011) was obtained from pβCE2TATA subjected to lactogenic hormone treatment (Figure 2B).

Figure 3 and 4 show the nucleotide sequence of the 5′-flanking region and intron 1 of the porcine β-casein gene. A computer-assisted search for the putative promoter/enhancer element (set at a cutoff score of >90%) was conducted using TFSEARCH (http://mbs.cbrc.jp/research/db/TFSEARCH.html). A typical TATA box was present at −32 and potential sites of C/EBPβ (CCAAT/Enhancer-Binding Protein β) are present at −1,846 and −2,110 (data not shown). The 5′ flanking region of the porcine β-casein gene also contained DNA motifs for SRY, CdxA, AML-a, GATA-3, and GATA-1. In addition, the first intron of the porcine β-casein gene contained transcriptional enhancer Oct-1, SRY, YY1, C/EBP β, AP-1, and the retroviral TATA box.