Go to Top Go to Bottom
Anim Biosci > Volume 35(7); 2022 > Article
Singh, Purohit, and Singh: Mitochondrial sequence based characterization and morphometric assessment of Diara buffalo population

Abstract

Objective

The present study is aimed at phenotypic characterization and mitochondrial d-loop analysis of indigenous “Diara” buffalo population, which are mostly confined to the villages on the South and North Gangetic marshy plains in the Bihar state of India. These buffaloes are well adapted and are best suited for ploughing and puddling the wet fields meant for paddy cultivation.

Methods

Biometric data on 172 buffaloes were collected using a standard flexible tape measure. Animals are medium in size; the typical morphometric features are long head with a broad forehead and moderately long and erect ears. Genomic DNA was isolated from unrelated animals. The mtDNA d-loop 358-bp sequence data was generated and compared with 338 sequences belonging to riverine and swamp buffaloes.

Results

Based on the mitochondrial d-loop analysis the Diara buffaloes were grouped along with the haplotypes reported for riverine buffalo. Sequence analysis revealed the presence of 7 mitochondrial D loop haplotypes with haplotype diversity of 0.9643. Five of the haplotypes were shared with established swamp breeds and with Buffalo population of Orissa in India.

Conclusion

Morphometric analyses clearly shows distinguishing features like long and broad forehead which may be useful in identification. The germplasm of Diara buffalo is much adapted to the marshy banks of river Ganga and its tributaries. It constitutes a valuable genetic resource which needs to be conserved on priority basis.

INTRODUCTION

The buffalo plays a very important role in the South Asian region economically and culturally. This region has a great biodiversity of buffalo, constituting 56% of the world buffalo population, which includes the well-known Murrah and Nili-Ravi breeds [1,2]. India is home to the high milk producing breeds of buffalo of the world. There are 19 well recognized buffalo breeds which constitute about 30% of the total buffalo population in the country [3]. However, 70% of the buffalo population in the country are still to be characterised and are known as non-descript. They possess the highest potential for production with a promising gene pool, which is still not fully utilised.
Mitochondrial genome is inherited through maternal lineage only, the DNA displacement loop of the mitochondrial genome (mtDNA D-loop) has been a prime target to carry out molecular evolutionary studies [4]. The higher mutation rate of mtDNA as compared to that of single copy nuclear genes makes mtDNA prime target for phylogenetic studies. It has provided significant insights into the domestication and past migration history of various livestock species.
Genetic studies using mitochondrial DNA (mtDNA) and the present-day distribution of buffalo breeds around the world have shown that swamp and river buffalo have been domesticated independently [1,5]. Based upon mitochondrial control region and cytochrome b sequence analysis it has been proposed that these two domestic types would have been derived independently from their respective wild ancestors that would have differed from each other at least at the level of subspecies [1]. Nagarajan et al [6] have analyzed 492-bp mtDNA control region sequences of riverine buffaloes sampled from India, Pakistan, Egypt, and Iran along with the available swamp sequences and provided genetic evidence that river buffalo were domesticated in Indian subcontinent and subsequently have reached Mesopotamia in ancient times from India. Earlier studies based on the TLR8 gene showed Assamese buffalo to be closer to the riverine buffaloes of eastern region like Chilika, Kalahandi, and Diara, as compared to buffalo population of Northern, Western, or Southern India [7].
River Ganga enters the state of Bihar from Chausa and divides state into two parts. Many of its tributaries Gandak, Bagmati, Kosi, Kali, Sone, Karmanasa, and Punpun enter river Ganga on its onward flow. The drainage pattern of Bihar is both trellis and dendritic. The villages on the South and North banks are densely populated with clusters of buffalo [8]. South and North Gangetic plains of river Ganga gets annual floods and is submerged under water. The waterlogged marshy habitation is well suited for these buffaloes which are well adapted to Taal and Diara areas of the river Ganges and its tributaries Sone and Gandak. Based on physical attributes, the farmers usually call these buffalo Deshila or “Diara buffalo”, or Punjabiya (graded Murrah). Diara buffalo are good milkers producing 7.8 litre average per day milk. The population remains so far largely untouched, management and breed improvement programmes could be undertaken to further improve the genetic potential of these buffaloes [8]. Characterisation of non-descript livestock and poultry populations are a mandated activity of ICAR-NBAGR. Hence the present study was undertaken to characterise this non-descript indigenous population based on morphometric and Mitochondrial d-loop analysis.

MATERIALS AND METHODS

Ethics statement

The study was approved by the Animal Ethics committee 2019-20/IRC-2.11, ICAR-National Bureau of Animal Genetic Resources, Karnal. All methods were carried out in accordance with guidelines and regulations of the concerned committee.

Morphometric data collection

A survey was conducted in villages of Patna, Ara, Chhapra, and Buxar districts situated on the banks of river Ganga in the Bihar state to collect and record information on various management practices of Diara buffalo. The information and management practices were collected by visiting 120 farmers of the 16 villages in the breeding tract based on standard procedure developed by ICAR-NBAGR for breed survey and registration.
Reproduction traits of Diara buffaloes were estimated based on the information provided by the farmers who rear these buffaloes. Performance traits like age at first calving, age at first service, daily milk yield, calving interval, lactation yield, peak yield, lactation length, dry period, service period and calving interval were recorded. Standard body measurements and physical characteristics were recorded from 132 animals of different age and sex, including calves. The body measurements data was analysed for descriptive statistics using MS-Excel [9]. Physical characterization of adult buffaloes and phenotypic correlations between different body biometric traits were estimated using partial correlations, using the SPSS (2001) [10].

Sample collection and genomic DNA isolation

Blood samples from the jugular vein of unrelated buffalo of both sexes were collectedfor mitochondrial DNA D-Loop analysis from various villages in the Diara buffaloes’ breeding region. DNA was isolated following standard protocol of SDS-Proteinase-K described by Sambrook and Russel [11]. The primers used to amplify mitochondrial D-loop segment were designed from buffalo complete mitochondrial sequences available in the GenBank database (Accession No. AF547270).
The primer set was F: 5′ AGTCCAAGCATCCCCCAAAATAAA 3′; R: 5′ CGGCCAGCATAATCGAAA 3′. The polymerase chain reaction (PCR) cycling conditions used were initial denaturation at 95°C for 3 min followed by 32 cycles of 94°C for 30 s; 58°C for 30 s; 72°C for 1 min with final extension at 72°C for 10 min. The amplified products were analysed on 1% TAE-agarose gel. After purification of PCR products, sequencing was performed using BigDye Terminator 3.1 Cycle Sequencing Kit (Applied Biosystem, Foster City, CA, USA) on an ABI 3130xl Automated DNA sequencer.

Sequencing and sequence analysis

Multiple sequence alignment of the edited nucleotide sequences was performed using MEGALIGN programme of Lasergene (DNASTAR Inc., Madison, WI, USA) [12]. Nucleotide sequence analysis of mtDNA D-loop haplotype sequences of Diara buffaloes was carried out by comparing with other reported Indian riverine populations (Assamese, Chilika, Kalahandi, Paralakhmundi, Marathwada, Murrah, South Kanara, Toda, Chhattisgarh, Dharwadi, Sambalpuri, and Manda) as well as a swamp population Meghalaya, Manipuri, Laos, Egypt, and Bangladeshi buffaloes. Mitochondrial D-loop haplotype sequence data for these populations were retrieved from the GenBank database, Chinese buffaloes, Carabao and Mediterranean buffaloes, while Bostaurus and Bosindicus were used as out-group [1316]. The evolutionary history was inferred using the Neighbour-Joining method [17]. Phylogenetic analyses were conducted in MEGA7 [18]. DNASP version 5.0 [19] was employed to analyze various genetic diversity parameters. NETWORK version 5.0 was utilized to draw the reduced median network [20].

RESULTS AND DISCUSSION

Diara buffaloes are smaller than the heavy-sized breeds like Murrah, Jaffarabadi, and Nili-Ravi with a height at withers of (138.12±4.5cm). The body hair coat colour varies from black to grey. The head is long with a broad forehead. Ears are moderately long and erect. The neck is moderately long. Horns are medium in size, flat, corrugated and curved, projecting backward, sideward, and upward reaching up to half of the neck. The tail is long, thin, and flexible ending in a black or black and white switch. Some animals showed white hairs on the forehead as well as on the forelimbs or in the pastern regions of hind limbs.
The Diara buffaloes are reared by farmers along the Ganga River. The breeding region of Diara buffaloes is almost linear along both sides of banks of river Ganges and its tributaries in Bihar. The region is almost marshy most of the year and dry enough for cultivation only during dry-weather conditions. Adult male animals are used for agricultural work in diara region, they are better suited for ploughing and puddling the wet fields meant for paddy cultivation, whereas females are used for milking. The herd size of Diara buffaloes is very small with an average being 3.1. The herd structure included almost nil adult males, 2.0 adult females, 0.2 male calves and 0.8 female calves. The black coloured animals are preferred over grey coloured by local farmers. Diara buffalo population has been influenced by continuous inter-se breeding within a population over a long period of time and inter-breeding with Murrah [21].

Body measurements

The mean and standard error of different body measurements in different age groups were recorded (Table 1). For adult male Diara buffalo of age above the three year the height at withers, was (138.12±4.5 cm), body length (130.26±5.1 cm), heart (chest) girth (208±2.5 cm), and for adult female animal it was found to be 129.77±2.24, 117.77±3.54, 192.31±5.67, respectively. There was no significant difference between male and female Diara buffalo animals based on morphometric traits. Chandran et al [8] studied morphometric and body weight traits of Diara buffaloes of different age groups.
The height at withers, body length and heart (chest) girth was 94.25±5.00 cm, 76.37±6.89 cm, and 117±10.12 cm in the 1 year age group calves. Moioli and Borghese [22] reported the height at withers in Murrah (142 cm) and Nagpuri (140 cm) in adult male buffaloes and 133 cm and 130 cm in adult female buffaloes, respectively, which are similar to the height at withers in Diara buffalo animals found in the study. Shankar and Mandal [23] have also reported the adult body weight of (461.789±3.32 kg) in Diara buffaloes.

Housing

Diara buffalo animals are housed close to the human dwellings. In most cases, closed housing is provided (85%) and the animals and humans are housed in different parts of the same building. Most of the constructions are permanent (85%) with thatched roofs covered with paddy straw, asbestos sheets, or tiled roofs. Floors are generally uneven brick layered without proper drainage facilities. The practice of allowing the animals to wallow in the nearby water sources is prevalent (90.5%). Traditional practice of taking animals for grazing in the marshy area of river Ganga and its tributaries is most prevalent, in the villages situated near the banks of water sources. In the evening, animals are brought in the closed house, milking is done in the evening as well as in the morning.
Stall feeding is also practiced by farmers having 2 to 3 animals, paddy straw, dry mixed grasses and green grasses are the main sources of roughage. Wheat bran, linseed oil cake, mustard oil cake and rice bran are given as concentrates. About two third of the farmers provide concentrates to the milking animals; 0.5 to 2 kg of concentrate is usually given to the lactating animals at the time of milking.

Breeding

Artificial insemination is primarily used for breeding and is now getting priority due to unavailability of breeding bulls and other practical difficulties faced by farmers. Semen of Diara buffaloes is not available and the farmers have to opt for Murrah semen, as a result, the proportion of graded Diara buffaloes (crossbred) and non-descript animals are more common in the urban areas.

Production performance

The udder is moderately developed with teats of medium size and squarely placed between the hind legs. Diara buffaloes are moderate milk producers and daily yield is 4 to 9 kg. The average daily milk yield was 4.9±0.4 kg as reported by the farmers. The length of lactation varied from 210 to 340 days per year with an average of 301.6±10.3 days per year. The lactation milk yield varied from 1,008.4±95.7 to 1,635.6 ±112 kg with a mean of 1,450.87±28.7 kg. Diara buffaloes have relatively long productive life spans, animals with more than five calvings were commonly found in the villages. Age at first calving and calving interval was estimated to be 46.27 ±0.63 months and 14.4±0.13 months, respectively. The dry period, average age at first service and service period was estimated to be 89.87±4.25 days, 34.86±0.78 months and 131.31 ±3.06 days, respectively. The different traits estimated above agree with Chandran et al [8].

Analysis of mitochondrial DNA D-loop sequence variation

Polymerase chain reaction successfully amplified the mitochondrial D-loop region of the buffalo samples. The two sequencing fragments were aligned and combined to produce a 358 bp mitochondrial D-loop DNA. The mtDNA D-loop sequences analysis of the sampled animals revealed seven haplotypes. Among the haplotypes found in Diara buffaloes, two haplotypes were distinct and one is shared only with Sambhalpuri buffalo while four haplotypes were found to be shared with Assam, Manipur and Meghalaya population from north-east India and also with Chilika, Kalahandi, Paralakhemundi, and Sambhalpuri breeds of Orissa, which has the character of wallowing in water and show similar habitat, these four haplotypes were also shared with Bangladesh, Mediterranean, and Egypt population which are established swamp population. The Diara buffaloes were grouped along with the haplotypes reported for riverine buffalo (Figure 1).
Mitochondrial D-loop sequence data of Diara buffaloes from Bihar were compared with other reported Indian riverine, Chinese, and Bangladeshi buffalo populations belonging to 23 different breeds (N = 342). Sequence analysis revealed the presence of 208 haplotypes, with a haplotype diversity of 0.9529±0.0045 and a nucleotide diversity of 0.03175±0.00126. The haplotype diversity ranged from 1 in South Kanara, Laos, and Egypt buffalo population to 0.7974 in Chhattisgarhi Indian population (Table 2). The genetic diversity across the different breeds followed the descending order pattern as per diversity richness, being highest in the northeast populations and lowest in central Indian riverine buffaloes. The Diara buffaloes showed highest values for nucleotide and haplotype diversity then Murrah buffaloes.

CONCLUSION

Diara buffalo population could be an offshoot from cross between Murrah and local buffaloes and it might have evolved due to continuous inter-se breeding within population over a long period of time. Morphometric and morphology analyses clearly show distinguishing features like fairly long and broad forehead which may be useful in identification. The animals are maintained in a low input small scale farming system and are vital for livelihood support to the farmers living on the banks of yearly flooding Ganga River. We have reported genetic diversity of the Diara buffalo population based on mitochondrial markers. The Diara population is under continuous threat in their breeding territory due to artificial insemination with the elite breeds. Intervention is needed to develop exclusive semen bank of genetically superior Diara buffalo bulls. Much data is still lacking for this indigenous population. Present study analysis may be used further for the Diara buffalo characterization for breed registration.

Notes

CONFLICT OF INTEREST

We certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript.

FUNDING

The authors wish to thank the Director, ICAR-NBAGR, Karnal (IRC-2.11), for support in carrying out the research work. The authors wish to thank the Director, Joint Directors and Veterinary Officers of Department of A.H. & Veterinary Services, Govt. of Bihar for their active support in carrying out the field work and collection of blood samples of buffaloes.

SUPPLEMENTARY MATERIAL

The sequence data generated under this study are available in the GenBank under accession numbers: MZ735963 - MZ735969.

ACKNOWLEDGMENTS

Authors extend special thanks to Dr Lavakumar Surarapu, NBAGR, Karnal for his assistance during the research work.

Figure 1
Network analysis using NETWORK 5.0, displaying median joining network based on, Mitochondrial D-loop haplotype of Diara buffalo with riverine buffalo, each haplotype is represented by a circle and the area of the circle is proportional to its frequency. Samples from different regions are mentioned in different colours. PM, Parakmundi; MGH, Meghalaya; SBP, Sambalpuri; DR, Diara; MD, Manda; CH, Chilika, CHG, Chatisgahri; DW, Dharwadi; SK, South Kanara; TD, Toda; Mu, Murrah; Med, Mediterranean; EG, Egypt; BD, Bangladesh; MN, Manipur; ASW, Assam; Cara, Carabao; CHE, Chinese; LA, Laos; Mtw, Marathwada; KH, Kalahandi.
ab-21-0265f1.jpg
Table 1
Mean±standard error of morphometric traits of Diara buffaloes in the breeding tract
Parameters (in cm) Young calves (<2 wk) Calves (6–12 mo) Young stock (1 to 3 yr) Adults
Animal No 10 12 12 Male (8) Female (90)
Height at wither 80±2 94.25±5.00 111.8±7.48 138.12±4.5 129.77±2.24
Body length horizontal 52.5±3.5 76.37±6.89 89.2±7.51 130.26±5.1 117.77±3.54
Body length oblique 57.5±4.5 87±5.69 101.20±9.24 141.25 ±5.2 129±3.50
Heart girth 80.5±2.5 117±10.12 150.8±15.24 208±2.5 192.31±5.67
Paunch girth 81.5±2.5 137±10.78 167.2±14.48 228±2.89 219.09±6.12
Leg 53.5±2.5 60±1.81 69±4.33 81.21±1.9 76.09±1.61
Neck 15±1 30.87±1.75 37.8±2.41 53.26±3.9 44.63±1.43
Neck circumstance 45±1 62.37±7.02 72.6±9.9 95.16±5.9 87±2.11
Face length 21±4 31.87±1.65 36.8±2.2 44.25±1.34 40.22±1.96
Face width 9.5±0.5 13.87±0.58 17.4±0.97 23.89±3.84 19.6±0.69
Ear length 15.5±2.5 22±0.96 25±0.89 27.20±1.29 26.09±0.95
Horn length - 8.14±2.56 21.2±3.24 34.3±1.98 32.1±2.08
Horn circumstance - 11.28±1.10 18±1.37 21.16±1.01 18.47±1.12
Distance between horns - 18.71±1.59 23.6±2.65 29.4±1.2 26.80±0.92
Hip bone 16.5±1.5 22.37±1.06 32.4±3.52 55.30 ±3.5 47.14±2.17
Hip height 75.19±3.83 106±16.5 112±16 135.46±2.75 126.41±1.95
Pin bone 8.5±0.5 12.25±1.57 21.2±4.95 26.9±1.95 25.4±1.61
Distance between hip and pin bone 22±2 26.37±1.96 31.2±2.47 40.23±2.3 37.3±1.54
Tail length 37.5±4.5 60±4.73 68±5.54 88.45±3.9 85.05±2.59
Tail length up to switch 43.5±4.5 70.25±5.75 77.8±5.01 97.79±3.5 95.65±3.33
Table 2
Mitochondrial D-loop haplotype diversity across buffalo populations/breeds
Sr. No. Population N H Hd Pi
1 Assamese 10 8 0.95556 0.01441
2 Chilika 41 13 0.8659 0.02025
3 Kalahandi 31 15 0.9161 0.01833
4 Paralakhemundi 43 21 0.9413 0.01537
5 Manipuri 24 17 0.9638 0.03624
6 Marathwada 5 4 0.9000 0.00412
7 Murrah 12 9 0.9545 0.01114
8 South Kanara 7 7 1.0 0.01870
9 Toda 7 6 0.9524 0.01249
10 Chhattisgarh 18 9 0.7974 0.01719
11 Dharwadi 20 11 0.8684 0.01327
12 Sambalpuri 40 20 0.9474 0.01463
13 Manda 24 14 0.8877 0.01667
14 Egypt 5 5 1.0 0.00104
15 Chinese 6 5 0.9333 0.00672
16 Bangladesh 5 4 0.9000 0.03152
17 Mediterranean 6 6 1.0000 0.01430
18 Laos 5 5 1.0 0.00517
19 Carabao 6 6 1.0000 0.00861
20 Bosindicus 2 2 1.0000 0.01781
21 Bostaurus 4 4 1.0000 0.00339
22 Diara 8 7 0.9643 0.01892
23 Meghalaya 13 10 0.9487 0.02842
Total - 342 208 0.9529 0.03175

N, number of animals; H, number of haplotypes; Hd, haplotype diversity; Pi, nucleotide diversity.

REFERENCES

1. Kumar S, Nagarajan M, Sandhu JS, Kumar N, Behl V, Nishanth G. Mitochondrial DNA analyses of Indian water buffalo support a distinct genetic origin of river and swamp buffalo. Anim Genet 2007; 38:227–32. https://doi.org/10.1111/j.1365-2052.2007.01602.x
crossref pmid
2. George M, Balaine DS, Vij PK, Kumar S. Conservation and management of buffalo genetic resources of India. Nagarcenkar R, editorBuffalo production and health. New Delhi, India: ICAR; 1988. p. 31–7.

3. ICAR-National Bureau of Animal Genetic Resources. 2022. [cited 2022 April 10]. Available from: https://nbagr.icar.gov.in/en/new-breeds-lines/

4. Liu J, Ding X, Zeng Y, et al. Genetic diversity and phylogenetic evolution of tibetan sheep based on mtDNA D-loop sequences. PLoS ONE 2016; 11:e0159308 https://doi.org/10.1371/journal.pone.0159308
crossref pmid pmc
5. Yindee M, Vlamings BH, Wajjwalku W, et al. Y-chromosomal variation confirms independent domestications of swamp and river buffalo. Anim Genet 2010; 41:433–5. https://doi.org/10.1111/j.1365-2052.2010.02020.x
crossref pmid
6. Nagarajan M, Nimisha K, Kumar S. Mitochondrial DNA variability of domesticriver buffalo (Bubalus bubalis) populations: genetic evidence for domestication of river buffalo in Indian subcontinent. Genome Biol Evol 2015; 7:1252–9. https://doi.org/10.1093/gbe/evv067
crossref pmid pmc
7. Dubey PK, Goyal S, Kumari N, Mishra SK, Arora R, Kataria RS. Genetic diversity within 5’upstream region of toll-like receptor 8 gene reveals differentiation of riverine and swamp buffaloes. Meta Gene 2013; 1:24–32. https://doi.org/10.1016/j.mgene.2013.08.001
crossref pmid pmc
8. Chandran P, Pandian SJ, Dey A, Kamal R, Kumari R. Production and reproduction performances of Diara buffaloes in the Gangetic basin of Bihar. Indian J Anim Sci 2015; 85:770–3.
crossref pdf
9. Microsoft Corporation. Microsoft Office Excel. 2007. Available from: https://office.microsoft.com/excel

10. IBM SPSS. Statistics for Windows (Desktop), Version 210. Armonk, NY, USA: IBM Corp; 2001.

11. Sambrook J, Russel DW. Molecular cloning: a laboratory manual 2001. 3rd ednCold Spring Harbour, New York, USA: Cold Spring Harbour Laboratory Press; 2001.

12. MegAlign Bioinformatics Software. Madison, WI, USA: DNASTAR; 2014.

13. Lei C, Zhang W, Chen H, et al. Two maternal lineages revealed by mitochondrial DNA D-loop sequences in Chinese native water buffaloes (Bubalus bubalis). Asian-Australas J Anim Sci 2007; 20:471–6. https://doi.org/10.5713/ajas.2007.471
crossref
14. Kierstein G, Vallinoto M, Silva A, Schneider MP, Iannuzzi L, Brenig B. Analysis of mitochondrial D-loop region casts new light on domestic water buffalo (Bubalus bubalis) phylogeny. Mol Phylogenet Evol 2004; 30:308–24. https://doi.org/10.1016/S1055-7903(03)00221-5
crossref pmid
15. Kataria RS, Kathiravan P, Bulandi SS, Yadav NK, Dubey PK, Mishra BP. Assessment of genetic diversity, mutation drift equilibrium and mitochondrial D-loop variation in Toda buffalo-the endangered breed of South India. J Appl Anim Res 2009; 35:67–72.
crossref
16. Mishra BP, Prakash B, Kataria RS, et al. Cytogenetic profiling and mitochondrial DNA analysis reveal existence of swamp buffalo population in Manipur state. Indian J Anim Sci 2010; 80:31–6.

17. Saitou N, Nei M. The neighbour-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987; 4:406–25.
pmid
18. Kumar S, Stecher G, Tamura K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol 2016; 33:1870–4. https://doi.org/10.1093/molbev/msw054
crossref pmid pmc
19. Librado P, Rozas J. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009; 25:1451–2. https://doi.org/10.1093/bioinformatics/btp187
crossref pmid
20. Bandelt HJ, Forster P, Rohl A. Median-joining networks for inferring intraspecific phylogenies. Mol Biol Evol 1999; 16:37–48. https://doi.org/10.1093/oxfordjournals.molbev.a026036
crossref pmid
21. Chandran PC, Jegaveera Pandian S, Reena K, Dey A. Socio-economic status and system of farming practices with Diara buffaloes in the middle gangetic plains of Bihar, India. Buffalo Bull 2019; 38:469–83.

22. Moioli B. Borghese A Buffalo production and research. Rome, Italy: Food and Agriculture Organization of the United Nations; 2005. p. 67–8.

23. Shankar S, Mandal KG. Genetic and non-genetic factors affecting body weight of buffaloes. Vet World 2010; 3:227–9.

TOOLS
METRICS Graph View
  • 0 Crossref
  •  0 Scopus
  • 2,248 View
  • 99 Download
Related articles


Editorial Office
Asian-Australasian Association of Animal Production Societies(AAAP)
Room 708 Sammo Sporex, 23, Sillim-ro 59-gil, Gwanak-gu, Seoul 08776, Korea   
TEL : +82-2-888-6558    FAX : +82-2-888-6559   
E-mail : editor@animbiosci.org               

Copyright © 2024 by Asian-Australasian Association of Animal Production Societies.

Developed in M2PI

Close layer
prev next